Previous Contig 013351:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF041I19Sequence835013351 (2)pir|D85171|D851714e-89OBP33pep like protein [imported] - Arabidopsis thaliana>gb:ATCHRIV41_1545354 Ara594013351 (2)pir|D85171|D851713e-25OBP33pep like protein [imported] - Arabidopsis thaliana>gb:ATCHRIV41_1545354 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041I19- GGCCAACTTCCAATTAAGCCAGTCTTCACTCTTCAGCCCTACACGGAGG
                      ____________________________________________________________
consensus GGCCAACTTCCAATTAAGCCAGTCTTCACTCTTCAGCCCTACACGGAGG
 
. : . : . : . : . : . :
JMSF041I19- CGGAGGGGCTGCAGCCACCGCGCGATTGGATACACAGTTTTACGCAATAATTAGATGGAA
                      ____________________________________________________________
consensus CGGAGGGGCTGCAGCCACCGCGCGATTGGATACACAGTTTTACGCAATAATTAGATGGAA
 
. : . : . : . : . : . :
JMSF041I19- AATGAGAAGAAAATAGAGAGCTATGTGGTGGTGCACAACATAGCGAAAAGGCATAACGTG
                      ____________________________________________________________
consensus AATGAGAAGAAAATAGAGAGCTATGTGGTGGTGCACAACATAGCGAAAAGGCATAACGTG
 
. : . : . : . : . : . :
JMSF041I19- GGGACACTAGCTCGCAGCGCCACCGCCTTCGGCGTCTCTGAACTGATTCTAGTCGGCCGG
                      ____________________________________________________________
consensus GGGACACTAGCTCGCAGCGCCACCGCCTTCGGCGTCTCTGAACTGATTCTAGTCGGCCGG
 
. : . : . : . : . : . :
JMSF041I19- CGAGACTTCAACGCCTTCGGCAGCCACGGTTCCACCTCTCACGTTCGCTTCCGCCACTTT
                      ____________________________________________________________
consensus CGAGACTTCAACGCCTTCGGCAGCCACGGTTCCACCTCTCACGTTCGCTTCCGCCACTTT
 
. : . : . : . : . : . :
JMSF041I19- CACTCCCTCTCTGACGCTAAAAACTTCCTCAAGGAGAGAGATTGTGACATATGTGGAGTG
                      ____________________________________________________________
consensus CACTCCCTCTCTGACGCTAAAAACTTCCTCAAGGAGAGAGATTGTGACATATGTGGAGTG
 
. : . : . : . : . : . :
JMSF041I19- GAGATTACGGAAAATGCAATGGCTGTGAATCAGCACCCTTTCAAGAGGAGTACTGCTTTT
                      ____________________________________________________________
consensus GAGATTACGGAAAATGCAATGGCTGTGAATCAGCACCCTTTCAAGAGGAGTACTGCTTTT
 
. : . : . : . : . : . :
JMSF041I19- CTCCTTGGTAATGAGGGAACAGGGCTTTCAGCTAAGGAATGTGAGATCTGTGACTTCTTT
                      ____________________________________________________________
consensus CTCCTTGGTAATGAGGGAACAGGGCTTTCAGCTAAGGAATGTGAGATCTGTGACTTCTTT
 
. : . : . : . : . : . :
JMSF041I19- GTTTACATTCCGCAGTAC-GGGTGTGGAACTGCATCTCTGAATGTCACTGTGGCAGCTTC
rJMSF041I19+ ATTCCGCAGTACNGGGTGTGGNACTGCATCTCTGAATGTCACTGTGGCAGCTTC
                      ____________________________________________________________
consensus GTTTACATTCCGCAGTACNGGGTGTGGAACTGCATCTCTGAATGTCACTGTGGCAGCTTC
 
. : . : . : . : . : . :
JMSF041I19- TATCGTTCTCCATCACTTTGGAGCTTGGGCCGGATTCCCTGAGATCTCGTGAAGGGAACA
rJMSF041I19+ TATCGTTCTCCATCACTTTGGAGCTTGGGCCGGATTCCCTGAGATCTCGTGAAGGGAACA
                      ____________________________________________________________
consensus TATCGTTCTCCATCACTTTGGAGCTTGGGCCGGATTCCCTGAGATCTCGTGAAGGGAACA
 
. : . : . : . : . : . :
JMSF041I19- AATATGTCGTTGCTGAAAGACCAAGTATGCAGGGTAAGAGAAATTACTGCATGGAAAGCG
rJMSF041I19+ AATATGTCGTTGCTGAAAGACCAAGTATGCAGGGTAAGAGAAATTACTGCATGGAAAGCG
                      ____________________________________________________________
consensus AATATGTCGTTGCTGAAAGACCAAGTATGCAGGGTAAGAGAAATTACTGCATGGAAAGCG
 
. : . : . : . : . : . :
JMSF041I19- CGGAATCGATTGCTGAAGAGCGAAAACTAAAAAAGGAAAATGCTTCAAATGGGTTCTTTG
rJMSF041I19+ CGGAATCGATTGCTGAAGAGCGAAAACTAAAAAAGGAAAATGCTTCAAATGGGTTCTTTG
                      ____________________________________________________________
consensus CGGAATCGATTGCTGAAGAGCGAAAACTAAAAAAGGAAAATGCTTCAAATGGGTTCTTTG
 
. : . : . : . : . : . :
JMSF041I19- ATGAGATTGGAAAAGAAGATTCTCCTTCCAACCTATTAGATACATTGTTTGCTGACTAGC
rJMSF041I19+ ATGAGATTGGAAAAGAAGATTCTCCTTCCAACCTATTAGATACATTGTTTGCTGACTAGC
                      ____________________________________________________________
consensus ATGAGATTGGAAAAGAAGATTCTCCTTCCAACCTATTAGATACATTGTTTGCTGACTAGC
 
. : . : . : . : . : . :
JMSF041I19- AAGGGAAGGGAACCCACCAGACTATCTCAATTAAATTCCCGCTCACAACTTAATCCAGTC
rJMSF041I19+ AAGGGAAGGGAACCCACCAGACTATCTCAATTAAATTCCCGCTCACAACTTAATCCAGTC
                      ____________________________________________________________
consensus AAGGGAAGGGAACCCACCAGACTATCTCAATTAAATTCCCGCTCACAACTTAATCCAGTC
 
. : . : . : . : . : . :
JMSF041I19- ATCATCT
rJMSF041I19+ ATCATCTCCACTCATTTGTTGCAGTAGATAGAAGCCCAGAAAGTACACAAATACAACCAT
                      ____________________________________________________________
consensus ATCATCTCCACTCATTTGTTGCAGTAGATAGAAGCCCAGAAAGTACACAAATACAACCAT
 
. : . : . : . : . : . :
rJMSF041I19+ CCATCGTAAGGGAACGGCAAACCAAGCCATCTGGAATCCAAGGAAAGTTTAGCTGATCAA
                      ____________________________________________________________
consensus CCATCGTAAGGGAACGGCAAACCAAGCCATCTGGAATCCAAGGAAAGTTTAGCTGATCAA
 
. : . : . : . : . : . :
rJMSF041I19+ TGAACCGAGCTAAAGATACCAAGAAACAAGTGTTGTATGACATATGTTCTGTTGTCAAGA
                      ____________________________________________________________
consensus TGAACCGAGCTAAAGATACCAAGAAACAAGTGTTGTATGACATATGTTCTGTTGTCAAGA
 
. : . : . : . : . : . :
rJMSF041I19+ TTAACTTCACAGGAAATCCTAGATTGTTTTAGCAGTTAGAGCTTAATTTGCTGCAGATAT
                      ____________________________________________________________
consensus TTAACTTCACAGGAAATCCTAGATTGTTTTAGCAGTTAGAGCTTAATTTGCTGCAGATAT