Previous Contig 013349:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF040E02Sequence547005682 (6)gb:AY057565_15639822e-16Arabidopsis thaliana AT4g01050/F2N1_31 mRNA, complete cds.>gb:AY057701_1564113 A762013349 (5)gb:AY057565_15639829e-25Arabidopsis thaliana AT4g01050/F2N1_31 mRNA, complete cds.>gb:AY057701_1564113 A
JMFF042M01Sequence658005682 (6)gb:AY057565_15639824e-31Arabidopsis thaliana AT4g01050/F2N1_31 mRNA, complete cds.>gb:AY057701_1564113 A615013349 (5)
JMSF017F22Sequence227005682 (6)718013349 (5)gb:AY057565_15639823e-20Arabidopsis thaliana AT4g01050/F2N1_31 mRNA, complete cds.>gb:AY057701_1564113 A
JMSF028J10Sequence670005682 (6)gb:AY057565_15639825e-37Arabidopsis thaliana AT4g01050/F2N1_31 mRNA, complete cds.>gb:AY057701_1564113 A722013349 (5)gb:AY057565_15639823e-12Arabidopsis thaliana AT4g01050/F2N1_31 mRNA, complete cds.>gb:AY057701_1564113 A
JMSF041I03Sequence794005682 (6)gb:AY057565_15639821e-53Arabidopsis thaliana AT4g01050/F2N1_31 mRNA, complete cds.>gb:AY057701_1564113 A767013349 (5)gb:AP004801_18453213e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P061

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF040E02+ CAGCAGCAGCTGGAATAGGAGC
                      ____________________________________________________________
consensus CAGCAGCAGCTGGAATAGGAGC
 
. : . : . : . : . : . :
rJMFF040E02+ ATTGGCGTTTTCAGAGGTAGAAACAATTCTTTCAACTGCTCGGTTCTGCTGCAATTATTC
rJMSF017F22+ ATTATTC
rJMSF028J10+ ATTATTC
                      ____________________________________________________________
consensus ATTGGCGTTTTCAGAGGTAGAAACAATTCTTTCAACTGCTCGGTTCTGCTGCAATTATTC
 
. : . : . : . : . : . :
rJMFF040E02+ AAGTTTTCAGCAAGAAACTGCTGTTTGCAGA-GGACAGAAAGAAAACACTTGAA-CAAGT
rJMSF017F22+ AAGTTTTCAGCAAGAAACTGCTGTTTGCAGA-GGACAGAAAGAAAACACTTGAA-CAAGT
rJMSF028J10+ AAGTTTTCAGCAAGAAACTGCTGTTTGCAGA-GGACAGAAAGAAAACACTTGAACCAAGT
rJMSF041I03+ AGAAACTGCTGGTTGCAGAGGGACAGAAAGAAAACACTTGAA-CGAGT
                      ____________________________________________________________
consensus AAGTTTTCAGCAAGAAACTGCTGTTTGCAGA-GGACAGAAAGAAAACACTTGAA-CAAGT
 
. : . : . : . : . : . :
rJMFF040E02+ TGATGAGTTCTTAAACACCAAGGTTGCTCCTAA-GGAGCTTGTAGATGAGATTAAGCAAA
rJMSF017F22+ TGATGAGTTCTTAAACACCAAGGTTGCTCCTAA-GGAGCTTGTAGATGAGATTAAGCAAA
rJMSF028J10+ TGATGAGTTCTTAAACACCAAGGTTGCTCCTAA-GGAGCTTGTAGATGAGATTAAGCAAA
rJMSF041I03+ TGATGAGTTCTTAAACACCAAGGTTGCTCCTAAGGGAGCTTGTAGATGAGATTAAGCAAA
                      ____________________________________________________________
consensus TGATGAGTTCTTAAACACCAAGGTTGCTCCTAA-GGAGCTTGTAGATGAGATTAAGCAAA
 
. : . : . : . : . : . :
rJMFF040E02+ TAGGGAAGGCACTTCTACCAACTCCAGTAAGTAGCAAGGCTCTACCTGCACCTACAGAGG
rJMSF017F22+ TAGGGAAGGCACTTCTACCAACTCCAGTAAGTAGCAAGGCTCTACCTGCACCTACAGAGG
rJMSF028J10+ TAGGGAAGGCACTTCTACCAACTCCAGTAAGTAGCAAGGCTCTACCTGCACCTACAGAGG
rJMFF042M01+ CAACTCCAGTAAGTAGCAAGGCTCTACCTGCACCTACAGAGG
rJMSF041I03+ TAGGGAAGGCACTTCTACCAACTCCAGTAAGTAGCAAGGCTCTACCTGCACCTACAGAGG
                      ____________________________________________________________
consensus TAGGGAAGGCACTTCTACCAACTCCAGTAAGTAGCAAGGCTCTACCTGCACCTACAGAGG
 
. : . : . : . : . : . :
rJMFF040E02+ AAAGCCCTCCTGCAGCAGCTGAATCAGTTTCAAACGTGAGCATTGCAACACCAAAAGAAG
rJMSF017F22+ AAAGCCCTCCTGCAGCAGCTGAATCAGTTTCAAACGTGAGCATTGCAACACCAAAAGAAG
rJMSF028J10+ AAAGCCCTCCTGCAGCAGCTGAATCAGTTTCAAACGTGAGCATTGCAACACCAAAAGAAG
rJMFF042M01+ AAAGCCCTCCTGCAGCAGCTGAATCAGTTTCAAACGTGAGCATTGCAACACCAAAAGAAG
rJMSF041I03+ AAAGCCCTCCTGCAGCAGCTGAATCAGTTTCAAACGTGAGCATTGCAACACCAAAAGAAG
                      ____________________________________________________________
consensus AAAGCCCTCCTGCAGCAGCTGAATCAGTTTCAAACGTGAGCATTGCAACACCAAAAGAAG
 
. : . : . : . : . : . :
rJMFF040E02+ AAGCAGCGCCTCCAGTGATCAATTCAGTTGCTAAAACAGAAGTAGTCCAAGCAGAAGAAG
rJMSF017F22+ AAGCAGCGCCTCCAGTGATCAATTCAGTTGCTAAAACAGAAGTAGTCCAAGCAGAAGAAG
rJMSF028J10+ AAGCAGCGCCTCCAGTGATCAATTCAGTTGCTAAAACAGAAGTAGTCCAAGCAGAAGAAG
rJMFF042M01+ AAGCAGCGCCTCCAGTGATCAATTCAGTTGCTAAAACAGAAGTAGTCCAAGCAGAAGAAG
rJMSF041I03+ AAGCAGCGCCTCCAGTGATCAATTCAGTTGCTAAAACAGAAGTAGTCCAAGCAGAAGAAG
                      ____________________________________________________________
consensus AAGCAGCGCCTCCAGTGATCAATTCAGTTGCTAAAACAGAAGTAGTCCAAGCAGAAGAAG
 
. : . : . : . : . : . :
rJMFF040E02+ CACCTACTGCAACCCCAACCCCAAGACCACTTTCTCCATATCCAAACTACCCGGATTTTA
rJMSF017F22+ CACCTACTGCAACCCCAACCCCAAGACCGCTTTCTCCATATCCAAACTACCCGGATTTTA
rJMSF028J10+ CACCTACTGCAACCCCAACCCCAAGACCGCTTTCTCCATATCCAAACTACCCGGATTTTA
rJMFF042M01+ CACCTACTGCAACCCCAACCCCAAGACCGCTTTCTCCATATCCAAACTACCCGGATTTTA
rJMSF041I03+ CACCTACTGCAACCCCAACCCCAAGACCGCTTTCTCCATATCCAAACTACCCGGATTTTA
                      ____________________________________________________________
consensus CACCTACTGCAACCCCAACCCCAAGACCGCTTTCTCCATATCCAAACTACCCGGATTTTA
 
. : . : . : . : . : . :
rJMFF040E02+ AGCCTCCATCCTCGCCAATGCCTTCACAGCCATAGATTCGATCGATCTTCTTGCAGATTA
rJMSF017F22+ AGCCTCCATCCTCGCCAATGCCTTCACAGCCATAGATTCGATCGATCTTCTTGCAGATTA
rJMSF028J10+ AGCCTCCATCCTCGCCAATGCCTTCACAGCCATAGATTCGATCGATCTTCTTGCAGATTA
rJMFF042M01+ AGCCTCCATCCTCGCCAATGCCTTCACAGCCATAGATTCGATCGATCTTCTTGCAGATTA
rJMSF041I03+ AGCCTCCATCCTCGCCAATGCCTTCACAGCCATAGATTCGATCGATCTTCTTGCAGATTA
                      ____________________________________________________________
consensus AGCCTCCATCCTCGCCAATGCCTTCACAGCCATAGATTCGATCGATCTTCTTGCAGATTA
 
. : . : . : . : . : . :
rJMFF040E02+ CAGCGTTGAAGTGCGTATATTAGTTACACATGCAGGTACTTAATTGTTTGTTTGTCCAAG
rJMSF017F22+ CAGCGTTGAAGTGCGTATATTAGTTACACATGCAGGTACTTAATTGTTTGTTTGTCCAAG
rJMSF028J10+ CAGCGTTGAAGTGCGTATATTAGTTACACATGCAGGTACTTAATTGTTTGTTTGTCCAAG
rJMFF042M01+ CAGCGTTGAAGTGCGTATATTAGTTACACATGCAGGTACTTAATTGTTTGTTTGTCCAAG
rJMSF041I03+ CAGCGTTGAAGTGCGTATATTAGTTACACATGCAGGTACTTAATTGTTTGTTTGTCCAAG
                      ____________________________________________________________
consensus CAGCGTTGAAGTGCGTATATTAGTTACACATGCAGGTACTTAATTGTTTGTTTGTCCAAG
 
. : . : . : . : . : . :
rJMFF040E02+ AATTATATATCAAAGCTAGCTAGCTAGCTACTTGTTCCTTGCAAGATTTTTGCTGTAAGA
rJMSF017F22+ AATTATATATCAAAGCTAGCTAGCTAGCTACTTGTTCCTTGCAAGATTTTTGCTGTAAGA
rJMSF028J10+ AATTATATATCAAAGCTAGCTAGCTAGCTACTTGTTCCTTGCAAGATTTTTGCTGTAAGA
rJMFF042M01+ AATTATATATCAAAGCTAGCTAGCTAGCTACTTGTTCCTTGCAAGATTTTTGCTGTAAGA
rJMSF041I03+ AATTATATATCAAAGCTAGCTAGCTAGCTACTTGTTCCTTGCAAGATTTTTGCTGTAAGA
                      ____________________________________________________________
consensus AATTATATATCAAAGCTAGCTAGCTAGCTACTTGTTCCTTGCAAGATTTTTGCTGTAAGA
 
. : . : . : . : . : . :
rJMFF040E02+ TAACTTTCAGCGCAAGAGCTAGAAGCTAGGAAAATTGAGCTAGAGGGGCCTTGGCTTTAA
rJMSF017F22+ TAACTTTCAGCGCAAGAGCTAGAAGCTAGGAAAATTGAGCTAGAGGGGCCTTGGCTTTAA
rJMSF028J10+ TAACTTTCAGCGCAAGAGCTAGAAGCTAGGAAAATTGAGCTAGAGGGGCCTTGGCTTTAA
rJMFF042M01+ TAACTTTCAGCGCAAGAGCTAGAAGCTAGGAAAATTGAGCTAGAGGGGCCTTGGCTTTAA
rJMSF041I03+ TAACTTTCAGCGCAAGAGCTAGAAGCTAGGAAAATTGAGCTAGAGGGGCCTTGGCTTTAA
                      ____________________________________________________________
consensus TAACTTTCAGCGCAAGAGCTAGAAGCTAGGAAAATTGAGCTAGAGGGGCCTTGGCTTTAA
 
. : . : . : . : . : . :
rJMFF040E02+ TTTTCTTCATGTCATGTCTGCATGTTTTACTATAATTTGTATTTTCACTATATGTTTGAT
rJMSF017F22+ TTTTCTTCATGTCATGTCTGCATGTTTTACTATAATTTGTATTTTCACTATATGTTTGAT
rJMSF028J10+ TTTTCTTCATGTCATGTCTGCATGTTTTACTATAATTTGTATTTTCACTATATGTTTGAT
rJMFF042M01+ TTTTCTTCATGTCATGTCTGCATGTTTTACTATAATTTGTATTTTCACTATATGTTTGAT
rJMSF041I03+ TTTTCTTCATGTCATGTCTGCATGTTTTACTATAATTTGTATTTTCACTATATGTTTGAT
                      ____________________________________________________________
consensus TTTTCTTCATGTCATGTCTGCATGTTTTACTATAATTTGTATTTTCACTATATGTTTGAT
 
. : . : . : . : . : . :
rJMFF040E02+ GTGATGTAGATGTAGTAGCTGAG
rJMSF017F22+ GTGATGTAGATGTAGTAGCTGAGTGTGAACGTGATTATATCATAAAA
rJMSF028J10+ GTGATGTAGATGTAGTAGCTGAGTGTGAACGTGATTATATCATAAAAT
rJMFF042M01+ GTGATGTAGATGTAGTAGCTGAGTGTGAACGTGATTATATCATAAAATTACAAATGGAAA
rJMSF041I03+ GTGATGTAGATGTAGTAGCTGAGTGTGAACGTGATTATATCATAAAATTACAAATGGAAA
                      ____________________________________________________________
consensus GTGATGTAGATGTAGTAGCTGAGTGTGAACGTGATTATATCATAAAATTACAAATGGAAA
 
. : . : . : . : . : . :
rJMFF042M01+ GTGAATAAATGCATGAATGTAACTATGAACTAC
rJMSF041I03+ GTGAATAAATGCATGAATGTAACTATGAACTACAGAACAGCAGGCAGCTAGATCCCGTCT
                      ____________________________________________________________
consensus GTGAATAAATGCATGAATGTAACTATGAACTACAGAACAGCAGGCAGCTAGATCCCGTCT