Previous Contig 013346:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF014I07Sequence247018888658013346 (2)gb:AY099582_15766083e-21Arabidopsis thaliana serine/threonine kinase-like protein (At4g23290) mRNA, comp
JMSF041H02Sequence791020102gb:ITU51740_16833071e-54Ipomoea trifida secreted glycoprotein 3 (ISG3) mRNA, complete cds.662013346 (2)pir|T10568|T105684e-21probable serine/threonine-specific protein kinase (EC 2.7.1.-) F25E4.100 - Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF041H02+ GG
                      ____________________________________________________________
consensus GG
 
. : . : . : . : . : . :
rJMSF014I07+ TGGTTATATGTCGCCGGAGTACGCTGGACA
rJMSF041H02+ AGCAAATACAAACCGAGCTGCTGGAACACTTGGTTATATGTCGCCGGAGTACGCTGGACA
                      ____________________________________________________________
consensus AGCAAATACAAACCGAGCTGCTGGAACACTTGGTTATATGTCGCCGGAGTACGCTGGACA
 
. : . : . : . : . : . :
rJMSF014I07+ TGGTGTCTTTTCCATTAAATCAGANGTGTTCAGCTTTGGNGTTTTGGTACTAGAAATTGT
rJMSF041H02+ TGGNGTCTTTTCCATTAAATCAGATGNGNTCAGCTTTGGTGNTTTGGTACTAGAAATTGT
                      ____________________________________________________________
consensus TGGTGTCTTTTCCATTAAATCAGATGTGTTCAGCTTTGGTGTTTTGGTACTAGAAATTGT
 
. : . : . : . : . : . :
rJMSF014I07+ GAGCGGGAAAAGAAATAGGGAATTTTNTCATCATCAAGNTCNCTATGNGAACCTTNTTGC
rJMSF041H02+ GAGCGGGAAAAGAAATAGGGAATTTTNTCATCATCAAGATCNCTATGNGAACCTTNTTGC
                      ____________________________________________________________
consensus GAGCGGGAAAAGAAATAGGGAATTTTNTCATCATCAAGATCNCTATGNGAACCTTNTTGC
 
. : . : . : . : . : . :
rJMSF014I07+ CCNTGTATGTCNCNCTTTTATGCATATTTATTTATTCNTTAAGTTTGAATTCAAGTCNTG
rJMSF041H02+ CCNTGTATGTCACNCTTTTANGCATATTTATTTATTCNTTAAGTTTGAATTCAAGTCNTG
                      ____________________________________________________________
consensus CCNTGTATGTCACNCTTTTATGCATATTTATTTATTCNTTAAGTTTGAATTCAAGTCNTG
 
. : . : . : . : . : . :
rJMSF014I07+ ATCTACTAANTTATATTTATTATAGGCNTGGAAGCTTTATAGNGATGGCNGNTTGATTGA
rJMSF041H02+ ATCTACTAANTTATATTTATTATAGGCNTGGAAGCNTTATAGNGATGGCNGATTGATTGA
                      ____________________________________________________________
consensus ATCTACTAANTTATATTTATTATAGGCNTGGAAGCTTTATAGNGATGGCNGATTGATTGA
 
. : . : . : . : . : . :
rJMSF014I07+ ACTTGTAGNCGNGCNTCTAGNTGCGCCNTGNGATTTGCCNCNAGTTNTAAGNTCNATCCN
rJMSF041H02+ ACTTGTAGACGNGCNTCTAGATGCGCCNTGTGATTTGCCNCAAGTTNTAAGATCNATCCN
                      ____________________________________________________________
consensus ACTTGTAGACGNGCNTCTAGATGCGCCNTGTGATTTGCCNCAAGTTNTAAGATCNATCCN
 
. : . : . : . : . : . :
rJMSF014I07+ TGTCAGCCTATTATGNGTTCAACNCTATCCTGAAGATAGGCCNAGCNCGTNTTCCNTAGT
rJMSF041H02+ TGTCAGCCTATTATGNGTTCAACNCTATCCTGAAGNTAGGCCNAGCNCGTNTTCCNTAGT
                      ____________________________________________________________
consensus TGTCAGCCTATTATGNGTTCAACNCTATCCTGAAGATAGGCCNAGCNCGTNTTCCNTAGT
 
. : . : . : . : . : . :
rJMSF014I07+ TCATATGTTAGCTAACAATGNTGAGTTACCCNTTGNTAAAGNGCCCGGNTTNTTCNCAAA
rJMSF041H02+ TCATATGTTAGNTAACNATGNTGNGTTACCCNTTGNTAAAGNGCCCGGNTTNTTCNCAAA
                      ____________________________________________________________
consensus TCATATGTTAGCTAACAATGNTGAGTTACCCNTTGNTAAAGNGCCCGGNTTNTTCNCAAA
 
. : . : . : . : . : . :
rJMSF014I07+ AACNAGGTTAAATGNGNCGAAGTNTTCTTTAGGCGNTGAAATATCNTGTTCTATAAATGA
rJMSF041H02+ AACAAGGTTAAATGNGNCGAAGTNTTCTTTAGGCGNTGAAATATCNTGTTCTATAAATGA
                      ____________________________________________________________
consensus AACAAGGTTAAATGNGNCGAAGTNTTCTTTAGGCGNTGAAATATCNTGTTCTATAAATGA
 
. : . : . : . : . : . :
rJMSF014I07+ AGTCNCCNTCTCATCNTTCGGTCCCCGTTAGAAAGNGNACNTATATAATAATTGAATAAT
rJMSF041H02+ AGTCNCCNTCTCATCNTTCGGTCCCCGTTAGAAAGNGTACNTATATAATAATTGAATAAT
                      ____________________________________________________________
consensus AGTCNCCNTCTCATCNTTCGGTCCCCGTTAGAAAGNGTACNTATATAATAATTGAATAAT
 
. : . : . : . : . : . :
rJMSF014I07+ TGAGNTACGNTTTTTTTTTTGAAAAACGTTATTTCTATTTATATTTACCCTAAGTTT
rJMSF041H02+ TGAGNTACGTTTTTTTTTTTGAAAAACGTTATTTCTATTTATATTTACCCTAAGTTTGTA
                      ____________________________________________________________
consensus TGAGNTACGTTTTTTTTTTTGAAAAACGTTATTTCTATTTATATTTACCCTAAGTTTGTA