Previous Contig 013342:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN007K10Sequence640013342 (2)gb:BT002733_16363365e-38Arabidopsis thaliana clone C104951 unknown protein (At3g07565) mRNA, complete cd
JMSF041G11Sequence535013342 (2)gb:BT002733_16363361e-49Arabidopsis thaliana clone C104951 unknown protein (At3g07565) mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN007K10+ CTTTAATCAACCAAACCCAACAAAAGGAGGAAGAAAACTGAGTACCACAGCA
                      ____________________________________________________________
consensus CTTTAATCAACCAAACCCAACAAAAGGAGGAAGAAAACTGAGTACCACAGCA
 
. : . : . : . : . : . :
JMFN007K10+ GGAACATTACAAAAGAAAGCTTAAAAAATGACCCCAAAAAAAAATAAATAAAAATAAAAA
                      ____________________________________________________________
consensus GGAACATTACAAAAGAAAGCTTAAAAAATGACCCCAAAAAAAAATAAATAAAAATAAAAA
 
. : . : . : . : . : . :
JMFN007K10+ CCAAAGAATATTCAAAGCAAATTTCCAACTGAGGTACAGAGCAGCAGCTTATTTTGCTAT
                      ____________________________________________________________
consensus CCAAAGAATATTCAAAGCAAATTTCCAACTGAGGTACAGAGCAGCAGCTTATTTTGCTAT
 
. : . : . : . : . : . :
JMFN007K10+ CTAATTATATAATCTGAGGGTCTGAGCTTGAGGGAAAATAGTCAGAAACATGATTAGTTA
                      ____________________________________________________________
consensus CTAATTATATAATCTGAGGGTCTGAGCTTGAGGGAAAATAGTCAGAAACATGATTAGTTA
 
. : . : . : . : . : . :
JMFN007K10+ GCACCGCGACAACAACCGGGATCTCAAGCCTGCTTTGGCAAGGGTGGCTGCGGAAGAAGT
                      ____________________________________________________________
consensus GCACCGCGACAACAACCGGGATCTCAAGCCTGCTTTGGCAAGGGTGGCTGCGGAAGAAGT
 
. : . : . : . : . : . :
JMFN007K10+ GTGCTGGCAAGCTCGTCGTTCAGCTTCACGGGGAGGGGTGGCATCTGCTTCATTATCTCC
                      ____________________________________________________________
consensus GTGCTGGCAAGCTCGTCGTTCAGCTTCACGGGGAGGGGTGGCATCTGCTTCATTATCTCC
 
. : . : . : . : . : . :
JMFN007K10+ GGCATATCGTTCATATCATTTAAGATCGAGAGGATATTATTTCGAGCCTGGCAGAGAAGA
rJMSF041G11+ ATCGTTCATATCATTTAAGATCGAGAGGATATTATNTCGAGCCTGGCAGAGAAGA
                      ____________________________________________________________
consensus GGCATATCGTTCATATCATTTAAGATCGAGAGGATATTATTTCGAGCCTGGCAGAGAAGA
 
. : . : . : . : . : . :
JMFN007K10+ CCGATGTTCTCATGTATCTTGAAAGCAGCAAAGTTTGTAGAAATCTGATCCAAGGCCTGG
rJMSF041G11+ CAGATGTTNTCATGTATCTNGAAAGCAGCAAAGTTNGTAGAAATCTGATCCAAGGCCTGG
                      ____________________________________________________________
consensus CCGATGTTCTCATGTATCTTGAAAGCAGCAAAGTTTGTAGAAATCTGATCCAAGGCCTGG
 
. : . : . : . : . : . :
JMFN007K10+ GCAGTTTGTTCAAGGAGCTGTCCAGCGGGGCCACCAATTGCTTTGTAGGATATACCATCA
rJMSF041G11+ GCAGTTTGTTCAAGGAGCTGTCCAGCGGGGCCACCAATTGCTTNGTAGGATATACCATCA
                      ____________________________________________________________
consensus GCAGTTTGTTCAAGGAGCTGTCCAGCGGGGCCACCAATTGCTTTGTAGGATATACCATCA
 
. : . : . : . : . : . :
JMFN007K10+ TCATTGTCCATGGATGTAGTAGATTGAGCATAGAAAGGGCCATTTGTAAGATTTGCAACA
rJMSF041G11+ TCATNGTCCATGGATGTAGTAGATTGAGCATAGAAAGGGCCATNTGTAAGATNTGCAACA
                      ____________________________________________________________
consensus TCATTGTCCATGGATGTAGTAGATTGAGCATAGAAAGGGCCATTTGTAAGATTTGCAACA
 
. : . : . : . : . : . :
JMFN007K10+ TGTGAAGATTTTGGCATAGACTCGGTTATCTTTTCCTTTTTGTCT
rJMSF041G11+ TGTGAAGATTTTGGCATAGANTCGGTTATCTTNTCCTTTTNGTCTNTACTTTTCCNTGAT
                      ____________________________________________________________
consensus TGTGAAGATTTTGGCATAGACTCGGTTATCTTTTCCTTTTTGTCTNTACTTTTCCNTGAT
 
. : . : . : . : . : . :
rJMSF041G11+ GAATTATGATCTTCTNTTCTCCTCNTGCTGTTTTCCTTTTTGGTCATCCATCTACATCTC
                      ____________________________________________________________
consensus GAATTATGATCTTCTNTTCTCCTCNTGCTGTTTTCCTTTTTGGTCATCCATCTACATCTC
 
. : . : . : . : . : . :
rJMSF041G11+ AGTGGTACATCTCGAACAGTNTTATCGTTTAACTGCATAGCAATTTTNGCATAACGGACT
                      ____________________________________________________________
consensus AGTGGTACATCTCGAACAGTNTTATCGTTTAACTGCATAGCAATTTTNGCATAACGGACT
 
. : . : . : . : . : . :
rJMSF041G11+ ATGTTGTTTTCNTTAGCATATGNNGNGAGCAATTCNTNCAATATAGACTGTTCCTCCGGA
                      ____________________________________________________________
consensus ATGTTGTTTTCNTTAGCATATGNNGNGAGCAATTCNTNCAATATAGACTGTTCCTCCGGA
 
. : . : . : . : . : . :
rJMSF041G11+ GTCCATTCCACGGAGATNCCAGGGTATGTGGCGGAGCGCGGCTNTGCGTAGCCCCCAACA
                      ____________________________________________________________
consensus GTCCATTCCACGGAGATNCCAGGGTATGTGGCGGAGCGCGGCTNTGCGTAGCCCCCAACA