Previous Contig 013341:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF035H09Sequence675013341 (8)pir|T51484|T514842e-58CRS2-like protein - Arabidopsis thaliana>gb:ATT21H19_1555115 Arabidopsis thalian688013341 (8)pir|T51484|T514842e-87CRS2-like protein - Arabidopsis thaliana>gb:ATT21H19_1555115 Arabidopsis thalian
JMSF041G10Sequence780013341 (8)pir|T51484|T514845e-70CRS2-like protein - Arabidopsis thaliana>gb:ATT21H19_1555115 Arabidopsis thalian753013341 (8)pir|T51484|T514842e-87CRS2-like protein - Arabidopsis thaliana>gb:ATT21H19_1555115 Arabidopsis thalian
JMSF042G10Sequence647013341 (8)pir|T51484|T514841e-45CRS2-like protein - Arabidopsis thaliana>gb:ATT21H19_1555115 Arabidopsis thalian798013341 (8)pir|T51484|T514841e-86CRS2-like protein - Arabidopsis thaliana>gb:ATT21H19_1555115 Arabidopsis thalian
JMSF052P07Sequence678013341 (8)gb:AP003214_18253209e-47Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN881013341 (8)pir|T51484|T514843e-87CRS2-like protein - Arabidopsis thaliana>gb:ATT21H19_1555115 Arabidopsis thalian

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052P07- GACGGGGGTCTATCCTTATTCCTTACATTACACAGCTACACTGTT
                      ____________________________________________________________
consensus GACGGGGGTCTATCCTTATTCCTTACATTACACAGCTACACTGTT
 
. : . : . : . : . : . :
JMSF052P07- AGGAAATAGGAATAGGCAATTGCTTTGGTCTTCCTTACTCCGTCACGCCTTCCGCTCTCA
JMSF042G10- ATAGGCAATTGCTTTGGTCTTCCTTACTCCNTCACGCCTTCCGCTCTCA
JMSF041G10- ATAGGCAATTGCTTTGGTCTTCCTTACTCCGTCACGCCTTCCGCTCTCA
                      ____________________________________________________________
consensus AGGAAATAGGAATAGGCAATTGCTTTGGTCTTCCTTACTCCGTCACGCCTTCCGCTCTCA
 
. : . : . : . : . : . :
JMSF052P07- CTCACGACTCGCTCAATCCAATCCTTCAC-TGC-TCTTCAGTTCTTCATATATCACTCGT
JMSF042G10- CTCACGACTCGCTCAATCCAATCCTTCACGTGCGTCTTCAGTTCTTCATATATCACTCGT
JMSF035H09- ATCACTCGT
JMSF041G10- CTCACGACTCGCTCAATCCAATCCTTCAC-TGC-TCTTCAGTTCTTCATATATCACTCGT
rJMSF052P07+ CTTCAGTTCTTCATATATCACTCGT
                      ____________________________________________________________
consensus CTCACGACTCGCTCAATCCAATCCTTCAC-TGC-TCTTCAGTTCTTCATATATCACTCGT
 
. : . : . : . : . : . :
JMSF052P07- CGGTGACAGGCAGAGAGATAAGAGGCTTCAGAGACGACCGCCTGCCTTGTCGTCCTTGCT
JMSF042G10- CGGTGACAGGCAGAGAGATAAGAGGCTTCAGAGACGACCGCCTGCCTTGTCGTCCTTGCT
JMSF035H09- CGGTGACAGGCAGAGAGATAAGAGGCTTCAGAGACGACCGCCTGCCTTGTCGTCCTTGCT
JMSF041G10- CGGTGACAGGCAGAGAGATAAGAGGCTTCAGAGACGACCGCCTGCCTTGTCGTCCTTGCT
rJMSF052P07+ CGGTGACAGGCAGAGAGATANGAGGCTTCAGAGACGACCGCCTGCCTTGTCGTCCTTGCT
                      ____________________________________________________________
consensus CGGTGACAGGCAGAGAGATAAGAGGCTTCAGAGACGACCGCCTGCCTTGTCGTCCTTGCT
 
. : . : . : . : . : . :
JMSF052P07- CGCCCTCGACTTTCATGTCAATGTTGTATTCTTTATCTCCTGCTAAAAGTTGCATGGTAC
JMSF042G10- CGCCCTCGACTTTCATGTCAATGTTGTATTCTTTATCTCCTGCTAAAAGTTGCATGGTAC
JMSF035H09- CGCCCTCGACTTTCATGTCAATGTTGTATTCTTTATCTCCTGCTAAAAGTTGTATGGTAC
JMSF041G10- CGCCCTCGACTTTCATGTCAATGTTGTATTCTTTATCTCCTGCTAAAAGTTGCATGGTAC
rJMSF052P07+ CGCCCTCGACTTTCATGTCAATGTTGTATTCTTTATCTCCTGCTAAAAGTTGCATGGTAC
rJMSF042G10+ CTAAAAGTTGCATGGTAC
                      ____________________________________________________________
consensus CGCCCTCGACTTTCATGTCAATGTTGTATTCTTTATCTCCTGCTAAAAGTTGCATGGTAC
 
. : . : . : . : . : . :
JMSF052P07- CCTATCCAAGATGCCCCTGTTCTCATCCAAGACATTTAGCTCCTGTGAGGATTAGAGCAT
JMSF042G10- CCTATCCAAGATGCCCCTGTTCTCATCCAAGACATTTAGCTCCTGTGAGGATTAGAGCAT
JMSF035H09- CCTATCCAAGATGCCCCTGTTCTCATCCAAGACATTTAGCTCCTGTGAGGATTAGAGCGT
JMSF041G10- CCTATCCAAGATGCCCCTGTTCTCATCCAAGACATTTAGCTCCTGTGAGGATTAGAGCAT
rJMSF035H09+ TCCAAGACATTTAGCTCCTGTGAGGATTAGAGCGT
rJMSF052P07+ CCTATCCAAGATGCCCCTGTTCTCATCCAAGACATTTAGCTCCTGTGAGGATTAGAGCAT
rJMSF042G10+ CCTATCCAAGATGCCCCTGTTCTCATCCAAGACATTTAGCTCCTGTGAGGATTAGAGCAT
rJMSF041G10+ CCAAGACATTTAGCTCCTGTGAGGATTAGAGCAT
                      ____________________________________________________________
consensus CCTATCCAAGATGCCCCTGTTCTCATCCAAGACATTTAGCTCCTGTGAGGATTAGAGCAT
 
. : . : . : . : . : . :
JMSF052P07- CAGCTTCACTGCCAGAGCCTAATGGAGCCAAAGTTGAGTACACTCCATGGTTGGTCGCAG
JMSF042G10- CAGCTTCACTGCCAGAGCCTAATGGAGCCAAAGTTGAGTACACTCCATGGTTGGTCGCAN
JMSF035H09- CAGCTTCACTGCCAGAGCCTAATGGAGCCAAAGTTGAGTATACTCCATGGTTGGTCGCAG
JMSF041G10- CAGCTTCACTGCCAGAGCCTAATGGAGCCAAAGTTGAGTACACTCCATGGTTGGTCGCAG
rJMSF035H09+ CAGCTTCACTGCCAGAGCCTAATGGAGCCAAAGTTGAGTATACTCCATGGTTGGTCGCAG
rJMSF052P07+ CAGCTTCACTGCCAGAGCCTAATGGAGCCAAAGTTGAGTACACTCCATGGTTGGTCGCAG
rJMSF042G10+ CAGCTTCACTGCCAGAGCCTAATGGAGCCAAAGTTGAGTACACTCCATGGTTGGTCGCAG
rJMSF041G10+ CAGCTTCACTGCCAGAGCCTAATGGAGCCAAAGTTGAGTACACTCCATGGTTGGTCGCAG
                      ____________________________________________________________
consensus CAGCTTCACTGCCAGAGCCTAATGGAGCCAAAGTTGAGTACACTCCATGGTTGGTCGCAG
 
. : . : . : . : . : . :
JMSF052P07- GACTGGGGAACCCTGGAAACAAGTACCATGGAACGCGGCACAATGTTGGTTTTGAAATGA
JMSF042G10- GACTGGGGAACCCTGGAAACAANTACCATGGAACGCGGCACAATGTTGGTTTTGAAATGA
JMSF035H09- GACTGGGGAACCCTGGAAACAAGTACCATGGAACGCGGCACAATGTTGGTTTTGAAATGA
JMSF041G10- GACTGGGGAACCCTGGAAACAAGTACCATGGAACGCGGCACAATGTTGGTTTTGAAATGA
rJMSF035H09+ GACTGGGGAACCCTGGAAACAAGTACCATGGAACGCGGCACAATGTTGGTTTTGAAATGA
rJMSF052P07+ GACTGGGGAACCCTGGAAACAAGTACCATGGAACGCGGCACAATGTTGGTTTTGAAATGA
rJMSF042G10+ GACTGGGGAACCCTGGAANCAAGTACCATGGAACGCGGCACAATGTTGGTTTTGAAATGA
rJMSF041G10+ GACTGGGGAACCCTGGAAACAAGTACCATGGAACGCGGCACAATGTTGGTTTTGAAATGA
                      ____________________________________________________________
consensus GACTGGGGAACCCTGGAAACAAGTACCATGGAACGCGGCACAATGTTGGTTTTGAAATGA
 
. : . : . : . : . : . :
JMSF052P07- TAGATCAGATTTCTCAAGAAGAGGGCATTTTGTTGAACACAATACAGTCAAAAGCATTGA
JMSF042G10- TAGATCANATTTCTCAAGAAGAGGGCATTTTGTTGAACACAATACAGNCAAAAGCNTTGA
JMSF035H09- TTGATCAGATTTCTCAAGAAGAGGGCATTTTGTTGAACACAATACAGTCAAAAGCATTGA
JMSF041G10- TAGATCAGATTTCTCAAGAAGAGGGCATTTTGTTGAACACAATACAGTCAAAAGCATTGA
rJMSF035H09+ TTGATCAGATTTCTCAAGAAGAGGGCATTTTGTTGAACACAATACAGTCAAAAGCATTGA
rJMSF052P07+ TAGATCAGATTTCTCAAGAAGAGGGCATTTTGTTGAACACAATACAGTCAAAAGCATTGA
rJMSF042G10+ TAGATCAGATTTCTCAAGAAGAGGGCATTTTGTTGAACACAATACAGTCAAAAGCATTGA
rJMSF041G10+ TAGATCAGATTTCTCAAGAAGAGGGCATTTTGTTGAACACAATACAGTCAAAAGCATTGA
                      ____________________________________________________________
consensus TAGATCAGATTTCTCAAGAAGAGGGCATTTTGTTGAACACAATACAGTCAAAAGCATTGA
 
. : . : . : . : . : . :
JMSF052P07- TTGGAATAGGTTCTATTGGAGAGGTGCCAGTGGTATTAGCAAAGCCTCAGACTTATATGA
JMSF042G10- TTGGAATAGGTTCTATTGGAGAGGTGCCAGTGGTATTAGCAAAGCCTCAGACTTATATGA
JMSF035H09- TTGGAATAGGTTCTATTGGAGAGGTGCCAGTGGTATTAGCAAAGCCTCAGACTTATATGA
JMSF041G10- TTGGAATAGGTTCTATTGGAGAGGTGCCAGTGGTATTAGCAAAGCCTCAGACTTATATGA
rJMSF035H09+ TTGGAATAGGTTCTATTGGAGAGGTGCCAGTGGTATTAGCAAAGCCTCAGACTTATATGA
rJMSF052P07+ TTGGAATAGGTTCTATTGGAGAGGTGCCAGTGGTATTAGCAAAGCCTCAGACTTATATGA
rJMSF042G10+ TTGGAATAGGTTCTATTGGAGAGGTGCCAGTGGTATTAGCAAAGCCTCAGACTTATATGA
rJMSF041G10+ TTGGAATAGGTTCTATTGGAGAGGTGCCAGTGGTATTAGCAAAGCCTCAGACTTATATGA
                      ____________________________________________________________
consensus TTGGAATAGGTTCTATTGGAGAGGTGCCAGTGGTATTAGCAAAGCCTCAGACTTATATGA
 
. : . : . : . : . : . :
JMSF052P07- ATTTCAGTGGAGAATCGGTTGGACAACTTGCTGCATATTATCAAGTACCCTTGCGACATA
JMSF042G10- ATTTCAGTGGAGAATCGGTTGGACAACTTGCTGCATATTATCANGTACCCTTGNGACATA
JMSF035H09- ATTTCAGTGGAGAATCGGTTGGACAACTTGCTGCATATTATCAAGTACCCTTGCGACATA
JMSF041G10- ATTTCAGTGGAGAATCGGTTGGACAACTTGCTGCATATTATCAAGTACCCTTGCGACATA
rJMSF035H09+ ATTTCAGTGGAGAATCGGTTGGACAACTTGCTGCATATTATCAAGTACCCTTGCGACATA
rJMSF052P07+ ATTTCAGTGGAGAATCGGTTGGACAACTTGCTGCATATTATCAAGTACCCTTGCGACATA
rJMSF042G10+ ATTTCAGTGGAGAATCGGTTGGACAACTTGCTGCATATTATCAAGTACCCTTGCGACATA
rJMSF041G10+ ATTTCAGTGGAGAATCGGTTGGACAACTTGCTGCATATTATCAAGTACCCTTGCGACATA
                      ____________________________________________________________
consensus ATTTCAGTGGAGAATCGGTTGGACAACTTGCTGCATATTATCAAGTACCCTTGCGACATA
 
. : . : . : . : . : . :
JMSF052P07- TCCTACTGGTTCATGACGAGATGAGTTTACCAAAT
JMSF042G10- TCCTACTGGTTCATGACNAGATGAGTTTACCAAATGGTGTTTTGAGGCTTAAGCCCA
JMSF035H09- TCCTACTGGTTCATGACGAGATGAGTTTACCAAATGGTGTTTTGAGGCTTAAGCCCAAGC
JMSF041G10- TCCTACTGGTTCATGACGAGATGAGTTTACCAAATGGTGTTTTGAGGCTTAAGCCCAAGC
rJMSF035H09+ TCCTACTGGTTCATGACGAGATGAGTTTACCAAATGGTGTTTTGAGGCTTAAGCCCAAGC
rJMSF052P07+ TCCTACTGGTTCATGACGAGATGAGTTTACCAAATGGTGTTTTGAGGCTTAAGCCCAAGC
rJMSF042G10+ TCCTACTGGTTCATGACGAGATGAGTTTACCAAATGGTGTTTTGAGGCTTAAGCCCAAGC
rJMSF041G10+ TCCTACTGGTTCATGACGAGATGAGTTTACCAAATGGTGTTTTGAGGCTTAAGCCCAAGC
                      ____________________________________________________________
consensus TCCTACTGGTTCATGACGAGATGAGTTTACCAAATGGTGTTTTGAGGCTTAAGCCCAAGC
 
. : . : . : . : . : . :
JMSF035H09- GAGGACATGGTCATCATAACGGGGTGAAAAGTGTAATGGAGCATCTGGATGGTTGC
JMSF041G10- GAGGACATGGCCATCATAACGGGGTGAAAAGTGTAATGGAGCATCTGGATGGTTGCCATC
rJMSF035H09+ GAGGACATGGTCATCATAACGGGGTGAAAAGTGTAATGGAGCATCTGGATGGTTGCCATC
rJMSF052P07+ GAGGACATGGCCATCATAACGGGGTGAAAAGTGTAATGGAGCATCTGGATGGTTGCCATC
rJMSF042G10+ GAGGACATGGCCATCATAACGGGGTGAAAAGTGTAATGGAGCATCTGGATGGTTGCCATC
rJMSF041G10+ GAGGACATGGCCATCATAACGGGGTGAAAAGTGTAATGGAGCATCTGGATGGTTGCCATC
                      ____________________________________________________________
consensus GAGGACATGGCCATCATAACGGGGTGAAAAGTGTAATGGAGCATCTGGATGGTTGCCATC
 
. : . : . : . : . : . :
JMSF041G10- AATTTCCACGACTTTGCATAGGAATAGGAAACCCACCGGGAGCAATGGATATGAAGGCTT
rJMSF035H09+ AATTTCCACGACTTTGCATAGGAATAGGAAACCCACCGGGAGCAATGGATATGAAGGCTT
rJMSF052P07+ AATTTCCACGACTTTGCATAGGAATAGGAAACCCACCGGGAGCAATGGATATGAAGGCTT
rJMSF042G10+ AATTTCCACGACTTTGCATAGGAATAGGAAACCCACCGGGAGCAATGGATATGAAGGCTT
rJMSF041G10+ AATTTCCACGACTTTGCATAGGAATAGGAAACCCACCGGGAGCAATGGATATGAAGGCTT
                      ____________________________________________________________
consensus AATTTCCACGACTTTGCATAGGAATAGGAAACCCACCGGGAGCAATGGATATGAAGGCTT
 
. : . : . : . : . : . :
JMSF041G10- TTCTTCTCCAGA
rJMSF035H09+ TTCTTCTCCAGAAATTCAGTGAAACAGAGCGGAAACAGGTGGATGAAGCACTGAAAGAAG
rJMSF052P07+ TTCTTCTCCAGAAATTCAGTGAAACAGAGCGGAAACAGGTAGATGAAGCACTGAAAGAAG
rJMSF042G10+ TTCTTCTCCAGAAATTCAGTGAAACAGAGCGGAAACAGGTAGATGAAGCACTGAAAGAAG
rJMSF041G10+ TTCTTCTCCAGAAATTCAGTGAAACAGAGCGGAAACAGGTAGATGAAGCACTGAAAGAAG
                      ____________________________________________________________
consensus TTCTTCTCCAGAAATTCAGTGAAACAGAGCGGAAACAGGTAGATGAAGCACTGAAAGAAG
 
. : . : . : . : . : . :
rJMSF035H09+ GGGCCGAGGCAGTGAGAACGCTGGTGCGAGAAGGAGTGGGCAGTAGACTAAGTAGATTTA
rJMSF052P07+ GGGCCGAGGCAGTGAGAACGCTGGTGCGAGAAGGAGTGGGCAGTAGACTAAGTAGATTTA
rJMSF042G10+ GGGCCGAGGCAGTGAGAACGCTGGTGCGAGAAGGAGTGGGCAGTAGACTAAGTAGATTTA
rJMSF041G10+ GGGCCGAGGCAGTGAGAACGCTGGTGCGAGAAGGAGTGGGCAGTAGACTAAGTAGATTTA
                      ____________________________________________________________
consensus GGGCCGAGGCAGTGAGAACGCTGGTGCGAGAAGGAGTGGGCAGTAGACTAAGTAGATTTA
 
. : . : . : . : . : . :
rJMSF035H09+ ATATAGGGCAGAAATACAAGTATCACAAAGTTTGATCATATGATCT
rJMSF052P07+ ATATAGGGCAGAAGTACAAGTATCACAAAGTTTGATCATATGATCTTGAACTCATGCATG
rJMSF042G10+ ATATAGGGCAGAAGTACAAGTATCACAAAGTTTGATCATATGATCTTGAACTCATGCATG
rJMSF041G10+ ATATAGGGCAGAAGTACAAGTATCACAAAGTTTGATCATATGATCTTGAACTCATGCATG
                      ____________________________________________________________
consensus ATATAGGGCAGAAGTACAAGTATCACAAAGTTTGATCATATGATCTTGAACTCATGCATG
 
. : . : . : . : . : . :
rJMSF052P07+ TACCTTCAGAAAGGAG
rJMSF042G10+ TACCTTCAGAAAGGAGTATTATTATATTGTTTGAACAATTTTGGGACTCCCTTGTATAGG
rJMSF041G10+ TACCTTCAGAAAGGAGTATTATTATATTGTTTG-ACAATTTTGGGACTCCCTTGTATAGG
                      ____________________________________________________________
consensus TACCTTCAGAAAGGAGTATTATTATATTGTTTGAACAATTTTGGGACTCCCTTGTATAGG