Previous Contig 013340:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF041G08Sequence818013340 (3)pir|T48212|T482121e-13hypothetical protein T20L15.180 - Arabidopsis thaliana>gb:ATT20L15_1555044 Arabi691013340 (3)
JMSF042G08Sequence715002480 (5)gb:AB011483_15115111e-17Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUF9.690013340 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041G08- GGGTCAAAGCTTCC
                      ____________________________________________________________
consensus GGGTCAAAGCTTCC
 
. : . : . : . : . : . :
JMSF041G08- AAAATGTTAGCTCAATCTCCCATCTCTGCAGGCCAGATCCAACACCTGAAAGCCGGCCGG
                      ____________________________________________________________
consensus AAAATGTTAGCTCAATCTCCCATCTCTGCAGGCCAGATCCAACACCTGAAAGCCGGCCGG
 
. : . : . : . : . : . :
JMSF041G08- AAGCCTCTCCAGCCAAAGAACGCTCCGGCGACTCCACTCGCCGCCGACGCAATCAAGCCC
                      ____________________________________________________________
consensus AAGCCTCTCCAGCCAAAGAACGCTCCGGCGACTCCACTCGCCGCCGACGCAATCAAGCCC
 
. : . : . : . : . : . :
JMSF041G08- AAACTGAAACCCGACTGGATCGAGATTTCACTGACCAACAGCTCGAACAACAAGGAAAAT
                      ____________________________________________________________
consensus AAACTGAAACCCGACTGGATCGAGATTTCACTGACCAACAGCTCGAACAACAAGGAAAAT
 
. : . : . : . : . : . :
JMSF041G08- GTCCATCCCCTGCACGCGCCGCCGCCGGCGAAGAGCAAGCCGAGCTGTAACATCGAGCTG
                      ____________________________________________________________
consensus GTCCATCCCCTGCACGCGCCGCCGCCGGCGAAGAGCAAGCCGAGCTGTAACATCGAGCTG
 
. : . : . : . : . : . :
JMSF041G08- TGCGATTCCTCGCTGGCGGAGGAGCTCAGCGCGATCCGGGAGAGGCTCGAGCGGTTGAGG
                      ____________________________________________________________
consensus TGCGATTCCTCGCTGGCGGAGGAGCTCAGCGCGATCCGGGAGAGGCTCGAGCGGTTGAGG
 
. : . : . : . : . : . :
JMSF041G08- ATCGACAAGCAGAAGACGGAGGAGATGCTCCGGGAGCGAGACGCGGCACTGGAGTTGCAG
                      ____________________________________________________________
consensus ATCGACAAGCAGAAGACGGAGGAGATGCTCCGGGAGCGAGACGCGGCACTGGAGTTGCAG
 
. : . : . : . : . : . :
JMSF041G08- ATGCGGGAGCTGATGAACAGAGGAGAAATCCAGAAGCAGCTCGAGCTCGAGGTCGATCGC
                      ____________________________________________________________
consensus ATGCGGGAGCTGATGAACAGAGGAGAAATCCAGAAGCAGCTCGAGCTCGAGGTCGATCGC
 
. : . : . : . : . : . :
JMSF041G08- CTCTTCCGATTGAAGGAGCTCCGAGTATCTTGTATGAGAATATCTCCGATTCAATCCCTC
rJMSF042G08+ TTGTATGAGAATATNTCCGATTCAATCCCTC
rJMSF041G08+ TTGTATGAGAATATCTCCGATTCAATCCCTC
                      ____________________________________________________________
consensus CTCTTCCGATTGAAGGAGCTCCGAGTATCTTGTATGAGAATATCTCCGATTCAATCCCTC
 
. : . : . : . : . : . :
JMSF041G08- AGAGATAAAGAAAGAGAGAAGAAGGGGAAAGAAGATCAATCCAAGGAAACGGCAGAAACT
rJMSF042G08+ AGAGATAAAGAAAGAGAGAAGAAGGGGAAAGAAGNTCNATCCAAGGNAACGGCAGAAACN
rJMSF041G08+ AGAGATAAAGAAAGAGAGAAGAAGGGGAAAGAAGATCAATCCAAGGAAACGGCAGAAACT
                      ____________________________________________________________
consensus AGAGATAAAGAAAGAGAGAAGAAGGGGAAAGAAGATCAATCCAAGGAAACGGCAGAAACT
 
. : . : . : . : . : . :
JMSF041G08- GAAGATGAAGAAGGATTGGAGTGTGGAATCCGACCGTCGAGCCCAAATTCAGATCTTGAT
rJMSF042G08+ GAAGATGAAGAAGGATTGGAGTGTGGAATCCGACCGTCGAGCCCAAATTCAGATCTTGAT
rJMSF041G08+ GAAGATGAAGAAGGATTGGAGTGTGGAATCCGACCGTCGAGCCCAAATTCAGATCTTGAT
                      ____________________________________________________________
consensus GAAGATGAAGAAGGATTGGAGTGTGGAATCCGACCGTCGAGCCCAAATTCAGATCTTGAT
 
. : . : . : . : . : . :
JMSF041G08- ACAGAGGAATGAAAAAGAAGAAACAAAATTTATGAGTATTTTTCACTTTTAGTAACTCAA
rJMSF042G08+ ACNGNGGAATGAAAAAGAAGNAACNAAATTTATGNGTATTTTTCNCTTTTAGTAACTCAA
rJMSF041G08+ ACNGAGGAATGAAAAAGAAGAAACNAAATTTATGAGTATTTTTCACTTTTAGTAACTCAA
                      ____________________________________________________________
consensus ACAGAGGAATGAAAAAGAAGAAACAAAATTTATGAGTATTTTTCACTTTTAGTAACTCAA
 
. : . : . : . : . : . :
JMSF041G08- CTTTCCTAATATTTTCACCTATAATCTTTCACCATCATTTTTCCACCATTAGTTTATCCG
rJMSF042G08+ CTTTCCTAATATTTTCNCCTATAATCTTTCNCCATCATTTTTCCNCCNTTAGTTTATCCG
rJMSF041G08+ CTTTCCTAATATTTTCACCTATAATCTTTCACCATCATTTTTCCNCCNTTAGTTTATCCG
                      ____________________________________________________________
consensus CTTTCCTAATATTTTCACCTATAATCTTTCACCATCATTTTTCCACCATTAGTTTATCCG
 
. : . : . : . : . : . :
JMSF041G08- TTTTGAATTTCTTATCACTTTTAATCATTTTGAAGAGTTTTTTGAGCAAGCATTACTTGA
rJMSF042G08+ TTTTGAATTTCTTATCNCTTTTAATCATTTTGAAGAGTTTTTTGAGCNAGCNTTACTTGA
rJMSF041G08+ TTTTGAATTTCTTATCACTTTTAATCNTTTTGAAGAGTTTTTTGAGCNAGCNTTACTTGA
                      ____________________________________________________________
consensus TTTTGAATTTCTTATCACTTTTAATCATTTTGAAGAGTTTTTTGAGCAAGCATTACTTGA
 
. : . : . : . : . : . :
JMSF041G08- AACTGGCATGTGCACAACGGTATT
rJMSF042G08+ AACTGGCATGTGCNCAACGGTATTTCNGGTGATGTTTAGCCTGAAAACTCTTTGAAAAGN
rJMSF041G08+ AACTGGCATGTGCNCAACGGTATTTCAGGTGATGTTTAGCCTGAAAACTCTTTGAAAAGA
                      ____________________________________________________________
consensus AACTGGCATGTGCACAACGGTATTTCAGGTGATGTTTAGCCTGAAAACTCTTTGAAAAGA
 
. : . : . : . : . : . :
rJMSF042G08+ CTAAAAATGGTAAAAACNTTTAAAGTAAAATGGAGTAATAGTGGAAAAAATGATAGTAGA
rJMSF041G08+ CTAAAAATGGTAAAAACNTTTAAAGTAAAATGGAGTAATAGTGGAAAAAATGATAGTAGA
                      ____________________________________________________________
consensus CTAAAAATGGTAAAAACNTTTAAAGTAAAATGGAGTAATAGTGGAAAAAATGATAGTAGA
 
. : . : . : . : . : . :
rJMSF042G08+ AATTATAAGTGGAAATGACCCAAATGTTGGAAAGGGTCNAAAGTGAAAAAAAAAATCAAG
rJMSF041G08+ AATTATAAGTGGAAATGACNCAAATGTTGGAAAGGGTCAAAAGTGAAAAAAAAAATCAAG
                      ____________________________________________________________
consensus AATTATAAGTGGAAATGACCCAAATGTTGGAAAGGGTCAAAAGTGAAAAAAAAAATCAAG
 
. : . : . : . : . : . :
rJMSF042G08+ ATTTATTTATACATTATTTATTTAGTGGTGTTGGTTGGGAGAAAGGGGGGGTGGTGGGGA
rJMSF041G08+ ATTTATTTATACATTATTTATTTAGTGGTGTTGGTTGGGAGAAAGGGGGGGTGGTGGGGA
                      ____________________________________________________________
consensus ATTTATTTATACATTATTTATTTAGTGGTGTTGGTTGGGAGAAAGGGGGGGTGGTGGGGA
 
. : . : . : . : . : . :
rJMSF042G08+ TGAGAAGAAACATGCACAATGCCTTATTGTATATGTTGGGTTTGTTTTGTAGTGTGTTTT
rJMSF041G08+ TGAGAAGAAACATGCACAATGCCTTATTGTATATGTTGGGTTTGTTTTGTAGTGTGTTTT
                      ____________________________________________________________
consensus TGAGAAGAAACATGCACAATGCCTTATTGTATATGTTGGGTTTGTTTTGTAGTGTGTTTT
 
. : . : . : . : . : . :
rJMSF042G08+ GGGGTTCATCTTTGAAGCCACGAGTTTGTGGACAGAAACAGCAATA-CCACTTTTGTTTC
rJMSF041G08+ GGGGTTCATCTTTGAAGCCACGAGTTTGTGGACAGAAACAGCAATACCCACTTTTGTTTC
                      ____________________________________________________________
consensus GGGGTTCATCTTTGAAGCCACGAGTTTGTGGACAGAAACAGCAATACCCACTTTTGTTTC