Previous Contig 013336:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008H19Sequence598013336 (10)pir|T52624|T526247e-44b-Zip DNA binding protein [imported] - Arabidopsis thaliana>gb:ATZ86093_1557551 699013336 (10)gb:AY466471_16080854e-24Oryza sativa (japonica cultivar-group) bZIP transcription factor RF2b (RF2b) mRN
JMFF008J17Sequence610013336 (10)pir|T52624|T526241e-45b-Zip DNA binding protein [imported] - Arabidopsis thaliana>gb:ATZ86093_1557551 708013336 (10)gb:AY466471_16080856e-17Oryza sativa (japonica cultivar-group) bZIP transcription factor RF2b (RF2b) mRN
JMSF003J16Sequence296013336 (10)pir|T52624|T526242e-07b-Zip DNA binding protein [imported] - Arabidopsis thaliana>gb:ATZ86093_1557551 734013336 (10)gb:AY466471_16080851e-38Oryza sativa (japonica cultivar-group) bZIP transcription factor RF2b (RF2b) mRN
JMSF041F01Sequence752013336 (10)pir|T52624|T526246e-16b-Zip DNA binding protein [imported] - Arabidopsis thaliana>gb:ATZ86093_1557551 740013336 (10)gb:AB092818_15251171e-08Lotus corniculatus var. japonicus LjPEPC-PK mRNA for phosphoenolpyruvate carboxy
JMSF052I08Sequence639013336 (10)pir|T52624|T526244e-45b-Zip DNA binding protein [imported] - Arabidopsis thaliana>gb:ATZ86093_1557551 891013336 (10)gb:AY822466_16288819e-62Pisum sativum AT-rich element binding factor 1 (ATF1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF008H19- ATTAATCAGCACAATAGTCAAGGCTTCCACATG
rJMFF008J17- CACATG
                      ____________________________________________________________
consensus ATTAATCAGCACAATAGTCAAGGCTTCCACATG
 
. : . : . : . : . : . :
rJMFF008H19- ATACAATGCATGAGAGTTCAACAATGAGTTGAGTATTACATGATTGATACAAAGAAGAAA
rJMFF008J17- ATACAATGCATGAGAGTTCAACAATGAGTTGAGTATTACATGATTGATACAAAGAAGAAA
rJMSF003J16- ACAATGAGTTGAGTATTACATGATTGATACAAAGAAGAAA
rJMSF052I08- ATGCATGAGAGTTCAACAATGAGTTGAGTATTACATGATTGATACAAAGAAGAAA
                      ____________________________________________________________
consensus ATACAATGCATGAGAGTTCAACAATGAGTTGAGTATTACATGATTGATACAAAGAAGAAA
 
. : . : . : . : . : . :
rJMFF008H19- CAAAAGAAAGATCAAAGAAACCCACTGCCACAACAACATCAAAGAATATAACATACTGCT
rJMFF008J17- CAAAAGAAAGATCAAAGAAACCCACTGCCACAACAACATCAAAGAATATAACATACTGCT
rJMSF003J16- CAAAAGAAAGATCAAAGAAACCCACTGCCACAACAACATCAAAGAATATAACATACTGCT
rJMSF052I08- CAAAAGAAAGATCAAAGAAACCCACTGCCACAACAACATCAAAGAATATAACATACTGCT
                      ____________________________________________________________
consensus CAAAAGAAAGATCAAAGAAACCCACTGCCACAACAACATCAAAGAATATAACATACTGCT
 
. : . : . : . : . : . :
rJMFF008H19- ACTACTAAGTCGAAGGTAAGAATCTAAAAATAATCGAAGAACAGTGAGTTCCCGGGATGT
rJMFF008J17- ACTACTAAGTCGAAGGTAAGAATCTAAAAATAATCGAAGAACAGTGAGTTCCCGGGATGT
rJMSF003J16- ACTACTAAGTCGAAGGTAAGAATCTAAAAATAATCGAAGAACAGTGAGTTCCCGGGATGT
rJMSF052I08- ACTACTAAGTCGAAGGTAAGAATCTAAAAATAATCGAAGAACAGTGAGTTCCCGGGATGT
                      ____________________________________________________________
consensus ACTACTAAGTCGAAGGTAAGAATCTAAAAATAATCGAAGAACAGTGAGTTCCCGGGATGT
 
. : . : . : . : . : . :
rJMFF008H19- TAAACATGGTGTCAGTCTATGAACAATTCAATAAATAGGGAGAGCTTGCGATCAGAATGT
rJMFF008J17- TAAACATGGTGTCAGTCTATGAACAATTCAATAAATAGGGAGAGCTTGCGATCAGAATGT
rJMSF003J16- TAAACATGGTGTCAGTCTATGAACAATTCAATAAATAGGGAGAGCTTGCGATCAGAATGT
rJMSF052I08- TAAACATGGTGTCAGTCTATGAACAATTCAATAAATAGGGAGAGCTTGCGATCAGAATGT
                      ____________________________________________________________
consensus TAAACATGGTGTCAGTCTATGAACAATTCAATAAATAGGGAGAGCTTGCGATCAGAATGT
 
. : . : . : . : . : . :
rJMFF008H19- ACTGCTGCTTTCGCTGGCAGATATGGTAGGAACTTCGGTCTTGATGAAATGGGACCCGCT
rJMFF008J17- ACTGCTGCTTTCGCTGGCAGATATGGTAGGAACTTCGGTCTTGATGAAATGGGACCCGCT
rJMSF003J16- ACTGCTGCTTTCGCTGGCAGATATGGTAGGAACTTCGGTCTTGATGAAATGGGACCCGCT
rJMSF052I08- ACTGCTGCTTTCGCTGGCAGATATGGTAGGAACTTCGGTCTTGATGAAATGGGACCCGCT
                      ____________________________________________________________
consensus ACTGCTGCTTTCGCTGGCAGATATGGTAGGAACTTCGGTCTTGATGAAATGGGACCCGCT
 
. : . : . : . : . : . :
rJMFF008H19- GCTATTGATATCAAGACCCTGGAAGCGCCCGAGAGGATCCTGGTTCAGTGTATGCAGGAG
rJMFF008J17- GCTATTGATATCAAGACCCTGGAAGCGCCCGAGAGGATCCTGGTTCAGTGTATGCAGGAG
rJMSF003J16- GCTATTGATATCAAGACCCTGGAAGCGCCCGAGAGGATCCTGGTTCAGTGTATGCAGGAG
rJMSF052I08- GCTATTGATATCAAGACCCTGGAAGCGCCCGAGAGGATCCTGGTTCAGTGTATGCAGGAG
                      ____________________________________________________________
consensus GCTATTGATATCAAGACCCTGGAAGCGCCCGAGAGGATCCTGGTTCAGTGTATGCAGGAG
 
. : . : . : . : . : . :
rJMFF008H19- AGCCTGTGCGTGGTTTCCTGCAAGAATGGGGTGATGGGGCGTAGATATGTTGGACCCGAG
rJMFF008J17- AGCCTGTGCGTGGTTTCCTGCAAGAATGGGGTGATGGGGCGTAGATATGTTGGACCCGAG
rJMSF003J16- AGCCTGTGCGTGGTTTCCTGCAAGAATGGGGTGATGGGGCGTAGATATGTTGGACCCGAG
rJMSF052I08- AGCCTGTGCGTGGTTTCCTGCAAGAATGGGGTGATGGGGCGTAGATATGTTGGACCCGAG
                      ____________________________________________________________
consensus AGCCTGTGCGTGGTTTCCTGCAAGAATGGGGTGATGGGGCGTAGATATGTTGGACCCGAG
 
. : . : . : . : . : . :
rJMFF008H19- AGGATGATACTGTGGCATTTGCATATTCTGGGAGTCGCTCGGGCCTAATTGTGGTTGATG
rJMFF008J17- AGGATGATACTGTGGCATTTGCATATTCTGGGAGTCGCTCGGGCCTAATTGTGGTTGATG
rJMSF003J16- AGGATGATACTGTGGCATTTGCATATTCTGGGAGTCGCTCGGGCCTAATTGTGGTTGATG
rJMSF052I08- AGGATGATACTGTGGCATTTGCATATTCTGGGAGTCGCTCGGGCCTAATTGTGGTTGATG
                      ____________________________________________________________
consensus AGGATGATACTGTGGCATTTGCATATTCTGGGAGTCGCTCGGGCCTAATTGTGGTTGATG
 
. : . : . : . : . : . :
rJMFF008H19- CGAAGAAAATAAGGTTGATTGGTTATAAGGAATATGTTGCATTCCAAAATTGTATGCATC
rJMFF008J17- CGAAGAAAATAAGGTTGATTGGTTATAAGGAATATGTTGCATTCCAAAATTGTATGCATC
rJMSF003J16- CGAAGAAAATAAGGTTGATTGGTTATAAGGAATATGTTGCATTCCAAAATTGTATGCATC
rJMSF052I08- CGAAGAAAATAAGGTTGATTGGTTATAAGGAATATGTTGCATTCCAAAATTGTATGCATC
                      ____________________________________________________________
consensus CGAAGAAAATAAGGTTGATTGGTTATAAGGAATATGTTGCATTCCAAAATTGTATGCATC
 
. : . : . : . : . : . :
rJMFF008H19- AGACGGGGCTGCCATTTCACCAGTCGCTATTCTGAGCCTCTCAACCTCCTGCTTCAGTGC
rJMFF008J17- AGACGGGGCTGCCATTTCACCAGTCGCTATTCTGAGCCTCTCAACCTCCTGCTTCAGTGC
rJMSF003J16- AGACGGGGCTGCCATTTCACCAGTCGCTATTCTGAGCCTCTCAACCTCCTGCTTCAGTGC
rJMSF052I08- AGACGGGGCTGCCATTTCACCAGTCGCTATTCTGAGCCTCTCAACCTCCTGCTTCAGTGC
                      ____________________________________________________________
consensus AGACGGGGCTGCCATTTCACCAGTCGCTATTCTGAGCCTCTCAACCTCCTGCTTCAGTGC
 
. : . : . : . : . : . :
rJMFF008H19- TTCGTTTAAAGCATCACGTAATTGAGCCTGNTGTTCCATGGCTTGCAAACGGAGCTTAAG
rJMFF008J17- TTCGTTTAAAGCATCACGTAATTGAGCCTGTTGTTCCCTGGCTTGCAAACNGAGCTTAAG
rJMSF003J16- TTCGTTTAAAGCATCACGTAATTGAGCCTGTTGTTCCATGGCTTGCAAACGGAGCTTAAG
rJMSF052I08- TTCGTTTAAAGCATCACGTAATTGAGCCTGTTGTTCCATGGCTTGCAAACGGAGCTTAAG
                      ____________________________________________________________
consensus TTCGTTTAAAGCATCACGTAATTGAGCCTGTTGTTCCATGGCTTGCAAACGGAGCTTAAG
 
. : . : . : . : . : . :
rJMFF008H19- CTCAGT
rJMFF008J17- CTCAGTGTTCTCATTAGTAAGACCAGTCGTATCCCTCTGGAA
rJMSF003J16- CTCAGTGTTCTCATTAGTAAGACCAGTCGTATCCCTCTGGAATAGGGTGAGCTGTGCAGA
rJMSF052I08- CTCAGTGTTCTCATTAGTAAGACCAGTCGTATCCCTCTGGAATAGGGTGAGCTGTGCAGA
JMFF008J17+ TCTGGAATAGGGTGAGCTGTGCAGA
JMFF008H19+ TGAGCTGTGCAGA
JMSF052I08+ TGGAATAGGGTGAGCTGTGCAGA
                      ____________________________________________________________
consensus CTCAGTGTTCTCATTAGTAAGACCAGTCGTATCCCTCTGGAATAGGGTGAGCTGTGCAGA
 
. : . : . : . : . : . :
rJMSF003J16- AAGAGTGGTTGCTTCTGTTTGAAGGGT
rJMSF052I08- AAGAGTGGTTGCTTCTGTTTGAAGGGTCTGAACTTTCCTCTCAAGCTCAGACATGTAATG
JMFF008J17+ AAGAGTGGTTGCTTCTGTTTGAAGGGTCTGAACTTTCCTCTCAAGCTCAGACATGTAATG
JMFF008H19+ AAGAGTGGTTGCTTCTGTTTGAAGGGTCTGAACTTTCCTCTCAAGCTCAGACATGTAATG
JMSF052I08+ AAGAGTGGTTGCTTCTGTTTGAAGGGTCTGAACTTTCCTCTCAAGCTCAGACATGTAATG
                      ____________________________________________________________
consensus AAGAGTGGTTGCTTCTGTTTGAAGGGTCTGAACTTTCCTCTCAAGCTCAGACATGTAATG
 
. : . : . : . : . : . :
rJMSF052I08- CGCCTTGCGCTCTTTCGATCGAGCAGCAGATTGCCTATTTGCCAGAATTCTTTTTGCCCT
JMFF008J17+ CGCCTTGCGCTCTTTCGATCGAGCAGCAGATTGCCTATTTGCCAGAATTCTTTTTGCCCT
JMFF008H19+ CGCCTTGCGCTCTTTCGATCGAGCAGCAGATTGCCTATTTGCCAGAATTCTTTTTGCCCT
JMSF052I08+ CGCCTTGCGCTCTTTCGATCGAGCAGCAGATTGCCTATTTGCCAGAATTCTTTTTGCCCT
                      ____________________________________________________________
consensus CGCCTTGCGCTCTTTCGATCGAGCAGCAGATTGCCTATTTGCCAGAATTCTTTTTGCCCT
 
. : . : . : . : . : . :
rJMSF052I08- TTTGGGATCAATGGTCCAGAGCTCAGCCAGTTTATCAGGCGCCATAGATTTCTTAG
JMFF008J17+ TTTGGGATCAATGGTCCAGAGCTCAGCCAGTTTATCAGGCGCCATAGATTTCTTAGCTTC
JMFF008H19+ TTTGGGATCAATGGTCCAGAGCTCAGCCAGTTTATCAGGCGCCATAGATTTCTTAGCTTC
JMSF052I08+ TTTGGGATCAATGGTCCAGAGCTCAGCCAGTTTATCAGGCGCCATAGATTTCTTAGCTTC
JMSF041F01- GCTCAGCCAGTTTATCAGGCGCCATAGTTTTCTTAGCGTA
                      ____________________________________________________________
consensus TTTGGGATCAATGGTCCAGAGCTCAGCCAGTTTATCAGGCGCCATAGATTTCTTAGCTTC
 
. : . : . : . : . : . :
JMFF008J17+ AATG---CCGCCATCGCCAAGCAGTAAGCCGGAGCTATCCACCGAGTTGCTATGGCGATG
JMFF008H19+ AATG---CCGCCATCGCCAAGCAGTAAGCCGGAGCTATCCACCGAGTTGCTATGGCGATG
JMSF052I08+ AATG---CCGCCATCGCCAAGCAGTAAGCCGGAGCTATCCACCGAGTTGCTATGGCGATG
JMSF041F01- AATGGCACCGACATCGCCAAGCAGTAAGCCGGAGCTATCCACCGAGTTGCTATGGCGATG
                      ____________________________________________________________
consensus AATG---CCGCCATCGCCAAGCAGTAAGCCGGAGCTATCCACCGAGTTGCTATGGCGATG
 
. : . : . : . : . : . :
JMFF008J17+ CCGCGGCCGGCTGGAGCTCTTCACCCCATTACCGCCATCGCAGCCTGCATTGTCAACACC
JMFF008H19+ CCGCGGCCGGCTGGAGCTCTTCACCCCATTACCGCCATCGCAGCCTGCATTGTCAACACC
JMSF052I08+ CCGCGGCCGGCTGGAGCTCTTCACCCCATTACCGCCATCGCAGCCTGCATTGTCAACACC
JMSF041F01- TCGCGGCCGGTTCGAGCTCTTCACCCCATTGCCGC---CGC---------TCTCCGCCCC
                      ____________________________________________________________
consensus CCGCGGCCGGCTGGAGCTCTTCACCCCATTACCGCCATCGCAGCCTGCATTGTCAACACC
 
. : . : . : . : . : . :
JMFF008J17+ CGCCGCCGCAGAAGCATCGGCG--GCGCCGGATCCGGCGCCGAGCTTCTCGATGTCCATG
JMFF008H19+ CGCCGCCGCAGAAGCATCGGCG--GCGCCGGATCCGGCGCCGAGCTTCTCGATGTCCATG
JMSF052I08+ CGCCGCCGCAGAAGCATCGGCG--GCGCCGGATCCGGCGCCGAGCTTCTCGATGTCCATG
JMSF041F01- TGCCGCCACAGAAGCATCGACGACTCGCCGGATCTGGCACCGAGCTTCTCGATGTCCATG
                      ____________________________________________________________
consensus CGCCGCCGCAGAAGCATCGGCG--GCGCCGGATCCGGCGCCGAGCTTCTCGATGTCCATG
 
. : . : . : . : . : . :
JMFF008J17+ TAAGTAGAGAAGAAATCGTCCTCGGATCCCATCTCCTCGAAGCTCCCGGCCGGCGCGGCG
JMFF008H19+ TAAGTAGAGAAGAAATCGTCCTCGGATCCCATCTCCTCGAAGCTCCCGGCCGGCGCGGCG
JMSF052I08+ TAAGTAGAGAAGAAATCGTCCTCGGATCCCATCTCCTCGAAGCTCCCGGCCGGCGCGGCG
JMSF003J16+ TCCCGGCCGGCGCGGCG
JMSF041F01- TAAGTAGAGAATAAATCGTCCTCGGATCCCATCTCCTCGAAGCTCCTGGCCGGCACGGCA
                      ____________________________________________________________
consensus TAAGTAGAGAAGAAATCGTCCTCGGATCCCATCTCCTCGAAGCTCCCGGCCGGCGCGGCG
 
. : . : . : . : . : . :
JMFF008J17+ GCGTCGAAGGGGTCGGACGCCAGATCCAGGTCCTCCGGCAGACGGAAGTTGACTTCGGAG
JMFF008H19+ GCGTCGAAGGGGTCGGACGCCAGATCCAGGTCCTCCGGCAGACGGAAGTTGACTTCGGAG
JMSF052I08+ GCGTCGAAGGGGTCGGACGCCAGATCCAGATCCTCCGGCAGACGGAAGTTGACTTCGGAG
JMSF003J16+ GCGTCGAAGGGGTCGGACGCCAGATCCAGATCCTCCGGCAGACGGAAGTTGACTTCGGAG
JMSF041F01- GTGTCGAAGGGGTCGGACTCCAGATCCAGATCCTTCGGCAGACGAAAGTTGACTTCAGAG
rJMSF041F01+ GACGAAAGTTGACTTCAGAG
                      ____________________________________________________________
consensus GCGTCGAAGGGGTCGGACGCCAGATCCAGATCCTCCGGCAGACGGAAGTTGACTTCGGAG
 
. : . : . : . : . : . :
JMFF008J17+ TGAGCCCTCCGGTGGTGCGATTGCCGGAATGCAGAGGGAAACGGCGGCGTTTGGTTGGCC
JMFF008H19+ TGAGCCCTCCGGTGGTGCGATTGCCGGAATGCAGAGGGAAACGGCGGCGTTTGGTTGGCC
JMSF052I08+ TGAGCCCTCCGGTGGTGCGATTGCCGGAATGCAGAGGGAAACGGCGGCGTTTGGTTGGCC
JMSF003J16+ TGAGCCCTCCGGTGGTGCGATTGCCGGAATGCAGAGGGAAACGGCGGCGTTTGGTTGGCC
JMSF041F01- TGAGCCCTCCGGTGGTGCGATTGTTGGAATGCAGAGGGAAACGGCGGCGTTTGGTTGGCC
rJMSF041F01+ TGAGCCCTCCGGTGGTGCGATTGTTGGAATGCAGAGGGAAACGGCGGCGTTTGGTTGGCC
                      ____________________________________________________________
consensus TGAGCCCTCCGGTGGTGCGATTGCCGGAATGCAGAGGGAAACGGCGGCGTTTGGTTGGCC
 
. : . : . : . : . : . :
JMFF008J17+ GATGGCTTCGAACCTGATGGATCTTGCATCTTGATGGGAGTGAAAAATGC
JMFF008H19+ GATGGCTTCGAACCTGATGGATCTTGCATCTTGATGGGAGTGAAAAATGC
JMSF052I08+ GATGGCTTCGAACCTGATGGATCTTGCATCTTGATGGGAGTGAAAAATGCAAGAAAACAA
JMSF003J16+ GATGGCTTCGAACCTGATGGATCTTGCATCTTGATGGGAGTGAAAAATGCAAGAAAACAA
JMSF041F01- AATGGCTTCGAACCTGATGGATCTTGCATCTTGATGGGAGTGGAAAATGCAAGAAAACAA
rJMSF041F01+ AATGGCTTCGAACCTGATGGATCTTGCATCTTGATGGGAGTGGAAAATGCAAGAAAACAA
                      ____________________________________________________________
consensus GATGGCTTCGAACCTGATGGATCTTGCATCTTGATGGGAGTGAAAAATGCAAGAAAACAA
 
. : . : . : . : . : . :
JMSF052I08+ ACAAACAAAACAACCCT
JMSF003J16+ ACAAACAAAACAACCCTTTTGTTGGGGAAGATTCAGAGGACAAAAAGGACGAAGCTTTTG
JMSF041F01- ACAAACAAAACAACCCTTTTGTTGGGGGAGATTCAAAAGATAAAAAGGACGAAGCTTTTG
rJMSF041F01+ ACAAACAAAACAACCCTTTTGTTGGGGGAGATTCAAAAGATAAAAAGGACGAAGCTTTTG
                      ____________________________________________________________
consensus ACAAACAAAACAACCCTTTTGTTGGGGGAGATTCAAAAGATAAAAAGGACGAAGCTTTTG
 
. : . : . : . : . : . :
JMSF003J16+ AGG---TGCAATGAAAGAAACAGGAAAGCGTA
JMSF041F01- AGGTGATGCAAAGAAAGAAACAGGAAAGCGTATGTAGCAACCAATAATGGCGGAAGTACA
rJMSF041F01+ AGGTGATGCAAAGAAAGAAACAGGAAAGCGTATGTAGCAACCAATAATGGCGGAAGTACA
                      ____________________________________________________________
consensus AGGTGATGCAAAGAAAGAAACAGGAAAGCGTATGTAGCAACCAATAATGGCGGAAGTACA
 
. : . : . : . : . : . :
JMSF041F01- GTTGAGTGTAGTGGTAATTGTTCACTGTTTCAATTTAGCGGTGGGTTTGACTCTTGTGAC
rJMSF041F01+ GTTGAGTGTAGTGGTAATTGTTCACTGTTTCAATTTAGCGGTGGGTTTGACTCTTGTGAC
                      ____________________________________________________________
consensus GTTGAGTGTAGTGGTAATTGTTCACTGTTTCAATTTAGCGGTGGGTTTGACTCTTGTGAC
 
. : . : . : . : . : . :
JMSF041F01- CATTGACCAGAAAAGGTTTCGACCGGATGCCCGGTGGGAGTCTCGTGGACTTTGAGGTTC
rJMSF041F01+ CATTGACCAGAAAAGGTTTCGACCGGATGCCCGGTGGGAGTCTCGTGGACTTTGAGGTTC
                      ____________________________________________________________
consensus CATTGACCAGAAAAGGTTTCGACCGGATGCCCGGTGGGAGTCTCGTGGACTTTGAGGTTC
 
. : . : . : . : . : . :
JMSF041F01- GACCAAATCTCAAATCTTTTGAG
rJMSF041F01+ GACCAAATCTCAAATCTTTTGAGGATCGACGGAGTGGTTCGGAGGGTGCGACGACGACCG
                      ____________________________________________________________
consensus GACCAAATCTCAAATCTTTTGAGGATCGACGGAGTGGTTCGGAGGGTGCGACGACGACCG
 
. : . : . : . : . : . :
rJMSF041F01+ GATGCCGGCGGTGGTCGAGACGCCGTACTACGCGGCGCCGAAGGTATTGATGCGTCGGGA
                      ____________________________________________________________
consensus GATGCCGGCGGTGGTCGAGACGCCGTACTACGCGGCGCCGAAGGTATTGATGCGTCGGGA
 
. : . : . : . : . : . :
rJMSF041F01+ GTACAATGAGAAGATCAGTTTCGCCGGAAGCAAAGGCTCTGCTGAGAAAGATGATCTGCA
                      ____________________________________________________________
consensus GTACAATGAGAAGATCAGTTTCGCCGGAAGCAAAGGCTCTGCTGAGAAAGATGATCTGCA
 
. : . : . : . : . : . :
rJMSF041F01+ TATGAGTGGTTCTCAAATTGAAATGGGTTAATCAATTAAATAATATAGGAAATTGTTGTA
                      ____________________________________________________________
consensus TATGAGTGGTTCTCAAATTGAAATGGGTTAATCAATTAAATAATATAGGAAATTGTTGTA
 
. : . : . : . : . : . :
rJMSF041F01+ AATAATATATTAAGTGTGACCATTATTAGTATTGATTATGTAACGGTTGGAGATTTATGA
                      ____________________________________________________________
consensus AATAATATATTAAGTGTGACCATTATTAGTATTGATTATGTAACGGTTGGAGATTTATGA
 
. : . : . : . : . : . :
rJMSF041F01+ CTACATTATGTCTTCCGTTACATTTGTATATTATATATGTTGTAGTTGTATAAGGATGAT
                      ____________________________________________________________
consensus CTACATTATGTCTTCCGTTACATTTGTATATTATATATGTTGTAGTTGTATAAGGATGAT