Previous Contig 013329:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012P04Sequence560000683 (6)gb:BT004058_16371671e-21Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina724013329 (3)gb:BT004058_16371676e-31Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina
JMFF036L20Sequence585000683 (6)gb:BT004058_16371678e-26Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina622013329 (3)gb:BT004058_16371677e-15Arabidopsis thaliana clone RAFL15-09-P09 (R20481) putative receptor protein kina
JMSF041C03Sequence274000683 (6)536013329 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF012P04+ ATC
                      ____________________________________________________________
consensus ATC
 
. : . : . : . : . : . :
rJMFF012P04+ TTGCACCAGAATATGCATATACAACGAGAGTGAACGAGAAGATTGATATCTATAGCTTCG
                      ____________________________________________________________
consensus TTGCACCAGAATATGCATATACAACGAGAGTGAACGAGAAGATTGATATCTATAGCTTCG
 
. : . : . : . : . : . :
rJMFF036L20+ GGGAGCCAAACTTCGGGGAGGAGCACACGA
rJMFF012P04+ GGGTGGTGCTGCTGGAGCTCGTGACAGGGAGGGAGCCAAACTTCGGGGAGGAGCACACGA
                      ____________________________________________________________
consensus GGGTGGTGCTGCTGGAGCTCGTGACAGGGAGGGAGCCAAACTTCGGGGAGGAGCACACGA
 
. : . : . : . : . : . :
rJMFF036L20+ GCCTCGCAGAATGGGCGTGGAAGAACTATGCAGAAGCGAGCAACATCGATGAAATGTTGG
rJMFF012P04+ GCCTCGCAGAATGGGCGTGGAAGAACTATGCAGAAGCGAGCAACATCGATGAAATGTTGG
                      ____________________________________________________________
consensus GCCTCGCAGAATGGGCGTGGAAGAACTATGCAGAAGCGAGCAACATCGATGAAATGTTGG
 
. : . : . : . : . : . :
rJMFF036L20+ ACGGGGAGATCAAGAAAGCGGGGTTCTTGGACGAGATGAGGACGGTGTTCACTCTCGGGC
rJMFF012P04+ ACGGGGAGATCAAGAAAGCGGGGTTCTTGGACGAGATGAGGACGGTGTTCACTCTCGGGC
                      ____________________________________________________________
consensus ACGGGGAGATCAAGAAAGCGGGGTTCTTGGACGAGATGAGGACGGTGTTCACTCTCGGGC
 
. : . : . : . : . : . :
rJMFF036L20+ TCATATGCACCAGTGCATCGCCTTCCAGCAGGCCGTCCATGAAAGAAGTCGTGCAGATTC
rJMFF012P04+ TCATATGCACCAGTGCATCGCCTTCCAGCAGGCCGTCCATGAAAGAAGTCGTGCAGATTC
rJMSF041C03+ ATGCACCAGTGCATCGCCTTCCAGCAGGCCGTCCATGAAAGAAGTCGTGCAGATTC
                      ____________________________________________________________
consensus TCATATGCACCAGTGCATCGCCTTCCAGCAGGCCGTCCATGAAAGAAGTCGTGCAGATTC
 
. : . : . : . : . : . :
rJMFF036L20+ TGCAGAGCTGCAGACCTCTGGATGAGTTCGAGAGGAAGATGTCCGGGAAAAACTGCGATG
rJMFF012P04+ TGCAGAGCTGCAGACCTCTGGATGAGTTCGAGAGGAAGATGTCCGGGAAAAACTGCGATG
rJMSF041C03+ TGCAGAGCTGCAGACCTCTGGATGAGTTCGAGAGGAAGATGTCCGGGAAAAACTGCGATG
                      ____________________________________________________________
consensus TGCAGAGCTGCAGACCTCTGGATGAGTTCGAGAGGAAGATGTCCGGGAAAAACTGCGATG
 
. : . : . : . : . : . :
rJMFF036L20+ TGGCGCCCCTCCTAGCTCGCAACGACGACAAGTATGTGGCGAGCTATAAACGTAGCTCGA
rJMFF012P04+ TGGCGCCCCTCCTAGCTCGCAACGACGACAAGTATGTGGCGAGCTATAAACGTAGCTCGA
rJMSF041C03+ TGGCGCCCCTCCTAGCTCGCAACGACGACAAGTATGTGGCGAGCTATAAACGTAGCTCGA
                      ____________________________________________________________
consensus TGGCGCCCCTCCTAGCTCGCAACGACGACAAGTATGTGGCGAGCTATAAACGTAGCTCGA
 
. : . : . : . : . : . :
rJMFF036L20+ GGAAGATTGCTGATGAAAGTGATGATGATAATCTGATGTTCAGTGTGTAACAAACACTGA
rJMFF012P04+ GGAAGATTGCTGATGAAAGTGATGATGATAATCTGATGTTCAGTGTGTAACAAACACTGA
rJMSF041C03+ GGAAGATTGCTGATGAAAGTGATGATGATAATCTGATGTTCAGTGTGTAACAAACACTGA
                      ____________________________________________________________
consensus GGAAGATTGCTGATGAAAGTGATGATGATAATCTGATGTTCAGTGTGTAACAAACACTGA
 
. : . : . : . : . : . :
rJMFF036L20+ GGTGATTTGGATTGTAATGAAATCATAACACAAGTAGTATTAGAGCAACCACATTAGTGG
rJMFF012P04+ GGTGATTTGGATTGTAATGAAATCATAACACAAGTAGTATTAGAGCAACCACATTAGTGG
rJMSF041C03+ GGTGATTTGGATTGTAATGAAATCATAACACAAGTAGTATTAGAGCAACCACATTAGTGG
                      ____________________________________________________________
consensus GGTGATTTGGATTGTAATGAAATCATAACACAAGTAGTATTAGAGCAACCACATTAGTGG
 
. : . : . : . : . : . :
rJMFF036L20+ TTTTTGCTCGGTTTTCAAGTTAAAAAGTGTTAAATTAATAGCAGTACGTGTAGCATATAG
rJMFF012P04+ TTTTTGCTCGGTTTTCAAGTTAAAAAGTGTTAAATTAATAGCAGTACGTGTAGCATATAG
rJMSF041C03+ TTTTTGCTCGGTTTTCAAGTTAAAAAGNGTTAAATTAATAGCAGTACGTGTAGCATATAG
                      ____________________________________________________________
consensus TTTTTGCTCGGTTTTCAAGTTAAAAAGTGTTAAATTAATAGCAGTACGTGTAGCATATAG
 
. : . : . : . : . : . :
rJMFF036L20+ TTGTAGTTTTGTGTGTCTTAGGTTGTAGAATTGTTTGTGTAACATAAACATTCGTACTAG
rJMFF012P04+ TTGTAGTTTTGTGTGTCTTAGGTTGTAGAATTGTTTGTGTAACATAAACATTCGTACTAG
rJMSF041C03+ TTGTAGTTTTGTGTGTCTTAGGTTGTAGAATTGTTTGTNTAACATAAACATTCGTACTAG
                      ____________________________________________________________
consensus TTGTAGTTTTGTGTGTCTTAGGTTGTAGAATTGTTTGTGTAACATAAACATTCGTACTAG
 
. : . : . : . : . : . :
rJMFF036L20+ CTAGCNGTTCAGAGTCCCCGGTCGGATGAACTGTAAGGTTCACCCTTTCAGG
rJMFF012P04+ CTAGCTGTTCAGAGTCCCCGGTCGGATGAACTGTAAGGTTCACCCTTTCAGGGCCAGTAA
rJMSF041C03+ CTANCTGTTCAGAGTCCCCGGTCGGATGAACTGTAAGGTTCACCCTTTCAGGGCCAGTAA
                      ____________________________________________________________
consensus CTAGCTGTTCAGAGTCCCCGGTCGGATGAACTGTAAGGTTCACCCTTTCAGGGCCAGTAA
 
. : . : . : . : . : . :
rJMFF012P04+ G
rJMSF041C03+ GTATACTTTGNNGGCCTTGGCCCTTGGGTGTGTGGTTTAAGAATTACGTTATCATAGGAG
                      ____________________________________________________________
consensus GTATACTTTGNNGGCCTTGGCCCTTGGGTGTGTGGTTTAAGAATTACGTTATCATAGGAG