Previous Contig 013323:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF041A03Sequence743013323 (4)gb:AY046035_15615251e-49Arabidopsis thaliana unknown protein (At1g71900) mRNA, complete cds.>gb:AY079390800013323 (4)gb:AC109595_17387219e-79Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1212_B02, complete s
JMSF052P02Sequence707013323 (4)gb:AE005172_8922462e-35Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC023279_153916867013323 (4)gb:AC109595_17387214e-94Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1212_B02, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052P02- GCAGC
                      ____________________________________________________________
consensus GCAGC
 
. : . : . : . : . : . :
JMSF052P02- AAATGCAAATCTACATCATCCGATCATCGATCTGATCAGACCTGAGTCCTGTTTCGGGTA
JMSF041A03- GAGTCCTGTTTCGGGTA
                      ____________________________________________________________
consensus AAATGCAAATCTACATCATCCGATCATCGATCTGATCAGACCTGAGTCCTGTTTCGGGTA
 
. : . : . : . : . : . :
JMSF052P02- AACCCAAATTCATTGTTTCTTCCCAGCCCCGATCTAGCACGGCAACGCGCTTCCTGCTGT
JMSF041A03- AACCCAAATTCATTGTTTCTTCCCAGCCCCGATCTAGCACGGCAACGCGCTTCCTGCTGT
                      ____________________________________________________________
consensus AACCCAAATTCATTGTTTCTTCCCAGCCCCGATCTAGCACGGCAACGCGCTTCCTGCTGT
 
. : . : . : . : . : . :
JMSF052P02- TCCCATCTGTGTGTTCCACCGCCGACAGATCCCACCACCCACCACTGGTTTATTCGACTT
JMSF041A03- TCCCATCTGTGTGTTCCACCGCCGACAGATCCCACCACCCACCACTGGTTTATTCGACTT
                      ____________________________________________________________
consensus TCCCATCTGTGTGTTCCACCGCCGACAGATCCCACCACCCACCACTGGTTTATTCGACTT
 
. : . : . : . : . : . :
JMSF052P02- CTGATTCGCTCTGTCAGGGAACTAAAGAGTAAGGATTCCGACTTTAACCAATCTAGACGC
JMSF041A03- CTGATTCGCTCTGTCAGGGAACTAAAGAGTAAGGATTCCGACTTTAACCAATCTAGACGC
                      ____________________________________________________________
consensus CTGATTCGCTCTGTCAGGGAACTAAAGAGTAAGGATTCCGACTTTAACCAATCTAGACGC
 
. : . : . : . : . : . :
JMSF052P02- ATTCGCGTTTGGAAATGAGGCAGTAGTGCTGTGGCGGCGGCGGAGGAGGAACCGGGTTTA
JMSF041A03- ATTCGCGTTTGGAAATGAGGCAGTAGTGCTGTGGCGGCGGCGGAGGAGGAACCGGGTTTA
                      ____________________________________________________________
consensus ATTCGCGTTTGGAAATGAGGCAGTAGTGCTGTGGCGGCGGCGGAGGAGGAACCGGGTTTA
 
. : . : . : . : . : . :
JMSF052P02- AGATTCTGTTTGATGGCGTTGGAAGCGACGGCGGCGACGGCGGCGGCGGTGTCGCATAGC
JMSF041A03- AGATTCTGTTTGATGGCGTTGGAAGCGACGGCGGCGACGGCGGCGGCGGTGTCGCATAGC
                      ____________________________________________________________
consensus AGATTCTGTTTGATGGCGTTGGAAGCGACGGCGGCGACGGCGGCGGCGGTGTCGCATAGC
 
. : . : . : . : . : . :
JMSF052P02- TGGAAGGATGCGTACAGAGGAATGTCGTCGGATAATGTTAAGGGGTTAGTTTTGGCGTTG
JMSF041A03- TGGAAGGATGCGTACAGAGGAATGTCGTCGGATAATGTTAAGGGGTTAGTTTTGGCGTTG
                      ____________________________________________________________
consensus TGGAAGGATGCGTACAGAGGAATGTCGTCGGATAATGTTAAGGGGTTAGTTTTGGCGTTG
 
. : . : . : . : . : . :
JMSF052P02- TCTTCCAGCGTTTTCATCGGTGCTAGCTTCATTGTTAAGAAGAAAGGGCTGAAGAAGGCC
JMSF041A03- TCTTCCAGCGTTTTCATCGGTGCTAGCTTCATTGTTAAGAAGAAAGGGCTGAAGAAGGCC
                      ____________________________________________________________
consensus TCTTCCAGCGTTTTCATCGGTGCTAGCTTCATTGTTAAGAAGAAAGGGCTGAAGAAGGCC
 
. : . : . : . : . : . :
JMSF052P02- GGTGCTTCTGGCGTCAGGGCTGGAGCCGGAGGATATTCATACCTATATGAGCCACTATGG
JMSF041A03- GGTGCTTCTGGCGTCAGGGCTGGAGCCGGAGGATATTCATACCTATATGAGCCACTATGG
                      ____________________________________________________________
consensus GGTGCTTCTGGCGTCAGGGCTGGAGCCGGAGGATATTCATACCTATATGAGCCACTATGG
 
. : . : . : . : . : . :
JMSF052P02- TGGGTGGGCATGATTACAATGATTGTTGGAGAAGTTGCCAATTTTGCAGCATATGCATTT
JMSF041A03- TGGGTGGGCATGATTACAATGATTGTTGGAGAAGTTGCCAATTTTGCAGCATATGCATTT
                      ____________________________________________________________
consensus TGGGTGGGCATGATTACAATGATTGTTGGAGAAGTTGCCAATTTTGCAGCATATGCATTT
 
. : . : . : . : . : . :
JMSF052P02- GCGCCCGCTATTCTGGTTACTCCTCTTGGTGCACTTAGCATTATCATAAGTGCCGTGCTA
JMSF041A03- GCGCCCGCTATTCTGGTTACTCCTCTTGGTGCACTTAGCATTATCATAAGTGCCGTGCTA
                      ____________________________________________________________
consensus GCGCCCGCTATTCTGGTTACTCCTCTTGGTGCACTTAGCATTATCATAAGTGCCGTGCTA
 
. : . : . : . : . : . :
JMSF052P02- GCTCACATTATTTTGCGGGAGAAGCTACATACGTTTGGCATT
JMSF041A03- GCTCACATTATTTTGCGGGAGAAGCTACATACGTTTGGCATTTTAGGTTGTGCTTTATGC
                      ____________________________________________________________
consensus GCTCACATTATTTTGCGGGAGAAGCTACATACGTTTGGCATTTTAGGTTGTGCTTTATGC
 
. : . : . : . : . : . :
JMSF041A03- GTGGTGGGCTCCACCACGATTGTTCTACATGCTCCTCAAGAACGCCAGATTGAATCGGTG
rJMSF052P02+ CTCCACCACGATTGTTCTACATGCTCCTCAAGAACGCCAGATTGAATCGGTG
                      ____________________________________________________________
consensus GTGGTGGGCTCCACCACGATTGTTCTACATGCTCCTCAAGAACGCCAGATTGAATCGGTG
 
. : . : . : . : . : . :
JMSF041A03- ACAG
rJMSF052P02+ ACAGAAGTGTGGGACCTTGCTACCGAGCCTGGTTTTCTCTTTTATGCATCCTTGGTGATA
rJMSF041A03+ TTTATGCATCCTTGGTGATA
                      ____________________________________________________________
consensus ACAGAAGTGTGGGACCTTGCTACCGAGCCTGGTTTTCTCTTTTATGCATCCTTGGTGATA
 
. : . : . : . : . : . :
rJMSF052P02+ ACGGCTGTTCTGATTCTCATATTTCACTATGTTCCACAATACGGGCAGACACATATAATG
rJMSF041A03+ ACGGCTGTTCTGATTCTCATATTTCACTATGTTCCACAATACGGGCAGACACATATAATG
                      ____________________________________________________________
consensus ACGGCTGTTCTGATTCTCATATTTCACTATGTTCCACAATACGGGCAGACACATATAATG
 
. : . : . : . : . : . :
rJMSF052P02+ TGCTATATTGGTATTTGTTCATTAATCGGTTCTTTATCGGTCATGAGTGTCAAAGCACTC
rJMSF041A03+ TGCTATATTGGTATTTGTTCATTAATCGGTTCTTTATCGGTCATGAGTGTCAAAGCACTC
                      ____________________________________________________________
consensus TGCTATATTGGTATTTGTTCATTAATCGGTTCTTTATCGGTCATGAGTGTCAAAGCACTC
 
. : . : . : . : . : . :
rJMSF052P02+ GGGATAGCCCTAAAGTTAACATTGTCGGGAATGAATCAGCTACTATATCCCCAGACTTGG
rJMSF041A03+ GGGATAGCCCTAAAGTTAACATTGTCGGGAATGAATCAGCTACTATATCCCCAGACTTGG
                      ____________________________________________________________
consensus GGGATAGCCCTAAAGTTAACATTGTCGGGAATGAATCAGCTACTATATCCCCAGACTTGG
 
. : . : . : . : . : . :
rJMSF052P02+ GCCTTTACTTTGGTTGTCCTGATTTGTGTGCTTACTCAAATGAATTACTTAAATATGGCC
rJMSF041A03+ GCCTTTACTTTGGTTGTCCTGATTTGTGTGCTTACTCAAATGAATTACTTAAATATGGCC
                      ____________________________________________________________
consensus GCCTTTACTTTGGTTGTCCTGATTTGTGTGCTTACTCAAATGAATTACTTAAATATGGCC
 
. : . : . : . : . : . :
rJMSF052P02+ CTGGACACGTTCAACACCGCTGTTGTGTCACCAATATATTATGTTATGTTCACGTCTCTA
rJMSF041A03+ CTGGACACGTTCAACACCGCTGTTGTGTCACCAATATATTATGTTATGTTCACGTCTCTA
                      ____________________________________________________________
consensus CTGGACACGTTCAACACCGCTGTTGTGTCACCAATATATTATGTTATGTTCACGTCTCTA
 
. : . : . : . : . : . :
rJMSF052P02+ ACTATCTTAGCAAGCGTAATCATGTTCAAGGACTGGGATAGGCAGAACCCTACCCAAATC
rJMSF041A03+ ACTATCTTAGCAAGCGTAATCATGTTCAAGGACTGGGATAGGCAGAACCCTACCCAAATC
                      ____________________________________________________________
consensus ACTATCTTAGCAAGCGTAATCATGTTCAAGGACTGGGATAGGCAGAACCCTACCCAAATC
 
. : . : . : . : . : . :
rJMSF052P02+ GTGACAGAAATGTGTGGGTTTGTCACGATACTTTCTGGCACGTTTCTTCTTCACAGCACC
rJMSF041A03+ GTGACAGAAATGTGTGGGTTTGTCACGATACTTTCTGGCACGTTTCTTCTTCACAGCACC
                      ____________________________________________________________
consensus GTGACAGAAATGTGTGGGTTTGTCACGATACTTTCTGGCACGTTTCTTCTTCACAGCACC
 
. : . : . : . : . : . :
rJMSF052P02+ AAAGACATGGTGGACGGTCCCATGGGGCACTCGGTCCGACTCCCCAAGCACGTTGATGAG
rJMSF041A03+ AAAGACATGGTGGACGGTCCCATGGGGCACTCGGTCCGACTCCCCAAGCACGTTGATGAG
                      ____________________________________________________________
consensus AAAGACATGGTGGACGGTCCCATGGGGCACTCGGTCCGACTCCCCAAGCACGTTGATGAG
 
. : . : . : . : . : . :
rJMSF052P02+ GACGGTTATGGTCAAGAAGGCGTGCCGTTGAAGCGCCAAGACTCCTCGAGATTGCCATGA
rJMSF041A03+ GACGGTTATGGTCAAGAAGGCGTGCCGTTGAAGCGCCAAGACTCCTCGAGATTGCCATGA
                      ____________________________________________________________
consensus GACGGTTATGGTCAAGAAGGCGTGCCGTTGAAGCGCCAAGACTCCTCGAGATTGCCATGA
 
. : . : . : . : . : . :
rJMSF052P02+ TATATAACTATATATATTGCTCCCGGATGCCTCGATATTTTTTTTCTCATTATTCTTTTT
rJMSF041A03+ TATATAACTATATATATTGCTCCCGGATGCCTCGATATTTTTTTTCTCATTATTCTTTTT
                      ____________________________________________________________
consensus TATATAACTATATATATTGCTCCCGGATGCCTCGATATTTTTTTTCTCATTATTCTTTTT
 
. : . : . : . : . : . :
rJMSF052P02+ TGCCACAGTTCTGCAGCATGGTCCACATCACATTCAAAGAAATACCACACTTGGAAATTG
rJMSF041A03+ TGCCACAGTTCTGCAGCATGGTCCACATCACATTCAAAGAAATACCACACTTGGAAATTG
                      ____________________________________________________________
consensus TGCCACAGTTCTGCAGCATGGTCCACATCACATTCAAAGAAATACCACACTTGGAAATTG
 
. : . : . : . : . : . :
rJMSF052P02+ CATTATTATTATTGTATTCTTTGTCCATCATGTAGTTCAAAGAAAGGGAAGGTGAGAGAG
rJMSF041A03+ CATTATTATTATTGTATTCTTTGTCCATCATGTAGTTCAAAGAAAGGGAAGGTGAGAGAG
                      ____________________________________________________________
consensus CATTATTATTATTGTATTCTTTGTCCATCATGTAGTTCAAAGAAAGGGAAGGTGAGAGAG
 
. : . : . : . : . : . :
rJMSF052P02+ ACTGTTGAAATTGTATTGTATTCTAATATTCTTTT
rJMSF041A03+ ACTGTTGAAATTGTATTGTATTCTAATATTCTTTTTCTATGAGTTCAAAGACAAAGAAGG
                      ____________________________________________________________
consensus ACTGTTGAAATTGTATTGTATTCTAATATTCTTTTTCTATGAGTTCAAAGACAAAGAAGG