Previous Contig 013320:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF040P04Sequence702013320 (2)gb:AB025624_15164678e-54Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MLD14.>gb:AY086503_157857013320 (2)pir|E96534|E965347e-77Hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005173_892909 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040P04- GGA
                      ____________________________________________________________
consensus GGA
 
. : . : . : . : . : . :
JMSF040P04- GAAAAGCCCCCAACGGCCTGCTTAGTTTGTCCCTCTGTTCCTCTCTCCGTATAGCACACC
                      ____________________________________________________________
consensus GAAAAGCCCCCAACGGCCTGCTTAGTTTGTCCCTCTGTTCCTCTCTCCGTATAGCACACC
 
. : . : . : . : . : . :
JMSF040P04- CTTTGCTTTTCCCCGACGAAGTTGAACACGGCTTAAAAACTCTAGAGCCAAGCAATACAG
                      ____________________________________________________________
consensus CTTTGCTTTTCCCCGACGAAGTTGAACACGGCTTAAAAACTCTAGAGCCAAGCAATACAG
 
. : . : . : . : . : . :
JMSF040P04- ATACAAATAGACAGAAAGAAAGACAGAGGGAGAGAAGAAACATGCCTGCAAGCTTAGACC
                      ____________________________________________________________
consensus ATACAAATAGACAGAAAGAAAGACAGAGGGAGAGAAGAAACATGCCTGCAAGCTTAGACC
 
. : . : . : . : . : . :
JMSF040P04- CATTGGATGTGGGGGGGATTCAGATCCCTTACCATTTCCGGTGTCCGATCTCTCTGGAGC
                      ____________________________________________________________
consensus CATTGGATGTGGGGGGGATTCAGATCCCTTACCATTTCCGGTGTCCGATCTCTCTGGAGC
 
. : . : . : . : . : . :
JMSF040P04- TTATGCGAGATCCGGTGACCGTTTGTACCGGTCAGACGTACGACAGAGCAAGCATAGAGT
                      ____________________________________________________________
consensus TTATGCGAGATCCGGTGACCGTTTGTACCGGTCAGACGTACGACAGAGCAAGCATAGAGT
 
. : . : . : . : . : . :
JMSF040P04- CTTGGGTGGCCACCGGTAATACGACGTGTCCGGTTACGAGAGCGCCTTTGACGGATTTTA
                      ____________________________________________________________
consensus CTTGGGTGGCCACCGGTAATACGACGTGTCCGGTTACGAGAGCGCCTTTGACGGATTTTA
 
. : . : . : . : . : . :
JMSF040P04- CTCTCATACCAAACCATACTCTCCGACGGCTCATCCAGGAGTGGTGCGTAGCGAACCGCG
                      ____________________________________________________________
consensus CTCTCATACCAAACCATACTCTCCGACGGCTCATCCAGGAGTGGTGCGTAGCGAACCGCG
 
. : . : . : . : . : . :
JMSF040P04- CCTTCGGTGTGGAGCGCATTCCTACGCCGAAGCAGCCTGCTGACCCGGGTTTGGTCCAGT
                      ____________________________________________________________
consensus CCTTCGGTGTGGAGCGCATTCCTACGCCGAAGCAGCCTGCTGACCCGGGTTTGGTCCAGT
 
. : . : . : . : . : . :
JMSF040P04- CCCTGTTGAGCCAAGCCTCGTCCGTGTCCAGTCATTTGAATTCCAGGCTTTCTGCACTGA
                      ____________________________________________________________
consensus CCCTGTTGAGCCAAGCCTCGTCCGTGTCCAGTCATTTGAATTCCAGGCTTTCTGCACTGA
 
. : . : . : . : . : . :
JMSF040P04- GGAGACTCAGAGGACTAGCTCGTGACTCGGATAAGAACCGGTCCGTGATTTCGGCGAATA
                      ____________________________________________________________
consensus GGAGACTCAGAGGACTAGCTCGTGACTCGGATAAGAACCGGTCCGTGATTTCGGCGAATA
 
. : . : . : . : . : . :
JMSF040P04- ACGCGCGCCAAGTTCTGCTCTCAATCGTGTTCTCCAATATGGATTCGAATTCGTCCGAGT
rJMSF040P04+ GAATTCGTCCGAGT
                      ____________________________________________________________
consensus ACGCGCGCCAAGTTCTGCTCTCAATCGTGTTCTCCAATATGGATTCGAATTCGTCCGAGT
 
. : . : . : . : . : . :
JMSF040P04- TAACTCACGAGGCGCTCTCGATTTTATCGATGTTCCAGC
rJMSF040P04+ TAACTCACGAGGCGCTCTCGATTTTATCGATGTTCCAGCTCTCGGAGGCGGAGTGCGTCT
                      ____________________________________________________________
consensus TAACTCACGAGGCGCTCTCGATTTTATCGATGTTCCAGCTCTCGGAGGCGGAGTGCGTCT
 
. : . : . : . : . : . :
rJMSF040P04+ TCGTAGCTTCCGATCTGGACCGAGTCGGATACCTCGTGTCTCTGCTCTCTCATCCTTCGA
                      ____________________________________________________________
consensus TCGTAGCTTCCGATCTGGACCGAGTCGGATACCTCGTGTCTCTGCTCTCTCATCCTTCGA
 
. : . : . : . : . : . :
rJMSF040P04+ TAGATGTTCGAGTTAACTCAGCTGCGTTGATAGAGTCCGTCGTCGCCGGAACGAAATCGC
                      ____________________________________________________________
consensus TAGATGTTCGAGTTAACTCAGCTGCGTTGATAGAGTCCGTCGTCGCCGGAACGAAATCGC
 
. : . : . : . : . : . :
rJMSF040P04+ CAGAACTACGATCTCAAATCAGCAATGCCGACGAAATCTTCCAAGGAATAGTCGGAATTC
                      ____________________________________________________________
consensus CAGAACTACGATCTCAAATCAGCAATGCCGACGAAATCTTCCAAGGAATAGTCGGAATTC
 
. : . : . : . : . : . :
rJMSF040P04+ TCAATCATCCGTCGACACATCCGAGAGCCTTGAAAATGGGAGTAAAGGCGCTGTTCGCCC
                      ____________________________________________________________
consensus TCAATCATCCGTCGACACATCCGAGAGCCTTGAAAATGGGAGTAAAGGCGCTGTTCGCCC
 
. : . : . : . : . : . :
rJMSF040P04+ TGTGCTTGGTGAAACAACACCGGCAAAAGGCGGTTATCGCGGGAGCAGTGGAAGCGTTGA
                      ____________________________________________________________
consensus TGTGCTTGGTGAAACAACACCGGCAAAAGGCGGTTATCGCGGGAGCAGTGGAAGCGTTGA
 
. : . : . : . : . : . :
rJMSF040P04+ TAGAGAGGTTGCAATACTTGGAAAAGTGCGACACCGAACGAGCGCTGGCCACGGTGGAGC
                      ____________________________________________________________
consensus TAGAGAGGTTGCAATACTTGGAAAAGTGCGACACCGAACGAGCGCTGGCCACGGTGGAGC
 
. : . : . : . : . : . :
rJMSF040P04+ TCCTCTGCCGGATTCCGTCCGGATGCGCGGCGTTCGCCGCCCACGCGCTGACCGTCCCGC
                      ____________________________________________________________
consensus TCCTCTGCCGGATTCCGTCCGGATGCGCGGCGTTCGCCGCCCACGCGCTGACCGTCCCGC
 
. : . : . : . : . : . :
rJMSF040P04+ TCCTCGTCAAAATCATCCTGAAGATCTCGGACCGAGCAACAGAGTACGCCGCTGGAGCTC
                      ____________________________________________________________
consensus TCCTCGTCAAAATCATCCTGAAGATCTCGGACCGAGCAACAGAGTACGCCGCTGGAGCTC
 
. : . : . : . : . : . :
rJMSF040P04+ TCCTCTCGCTTTGCTCCTCCTCCGAACAAGCTCAGCGCGACGCCGTGGCCGCCGGCGTAT
                      ____________________________________________________________
consensus TCCTCTCGCTTTGCTCCTCCTCCGAACAAGCTCAGCGCGACGCCGTGGCCGCCGGCGTAT
 
. : . : . : . : . : . :
rJMSF040P04+ TGACTCAATTACTACTGCTCGTCCAGAGCGGCTGCACAGAGCGAGCGAAACGGAAAGCGC
                      ____________________________________________________________
consensus TGACTCAATTACTACTGCTCGTCCAGAGCGGCTGCACAGAGCGAGCGAAACGGAAAGCGC
 
. : . : . : . : . : . :
rJMSF040P04+ AAATGCTTTTGAAACTGCTCCGCGATTGTTGGCCCGACGATTCCATTGTAAATTCAGATG
                      ____________________________________________________________
consensus AAATGCTTTTGAAACTGCTCCGCGATTGTTGGCCCGACGATTCCATTGTAAATTCAGATG
 
. : . : . : . : . : . :
rJMSF040P04+ ATTTTGCTCGCAGCGACGTCGTTCAGTTTTTACGATAGACCAATTACCATTTACCAATAC
                      ____________________________________________________________
consensus ATTTTGCTCGCAGCGACGTCGTTCAGTTTTTACGATAGACCAATTACCATTTACCAATAC
 
. : . : . : . : . : . :
rJMSF040P04+ CCCTTTTTGTAATTTCAGGTAAAAATTTAAACCGTCAAAAACAAAAAACTACCGACTATA
                      ____________________________________________________________
consensus CCCTTTTTGTAATTTCAGGTAAAAATTTAAACCGTCAAAAACAAAAAACTACCGACTATA