Previous Contig 013310:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001A05Sequence193007372 (3)766013310 (3)gb:AP005967_18603902e-06Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B108
JMSF026E10Sequence661007372 (3)737013310 (3)gb:AY086268_15713212e-09Arabidopsis thaliana clone 231948 mRNA, complete sequence.
JMSF040M11Sequence630007372 (3)878013310 (3)gb:AP005967_18603903e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B108

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040M11+ CTTGGGGAGCTTGATCCACCTCCATGGCTTAACAGAAT
                      ____________________________________________________________
consensus CTTGGGGAGCTTGATCCACCTCCATGGCTTAACAGAAT
 
. : . : . : . : . : . :
rJMSF040M11+ GCGGGAAATAGGATATCCACCAGGCTATCTAGATCCAGATAATGAGGATATGCCCTCAGG
                      ____________________________________________________________
consensus GCGGGAAATAGGATATCCACCAGGCTATCTAGATCCAGATAATGAGGATATGCCCTCAGG
 
. : . : . : . : . : . :
rJMSF026E10+ CAGAGGAAGGAGAAATTCTCGA
rJMSF001A05+ ATTTGCTGACGAGGAGATTGAAGAGGAACCAGAGGAAGGAGAAATTCTCGA
rJMSF040M11+ GATCACAATATTTGCTGACGAGGAGATTGAAGAGGAAACAGAGGAAGGAGAAATTCTCGA
                      ____________________________________________________________
consensus GATCACAATATTTGCTGACGAGGAGATTGAAGAGGAACCAGAGGAAGGAGAAATTCTCGA
 
. : . : . : . : . : . :
rJMSF026E10+ GAAGAGTGATCCAGAGCCACCACCTAAGAAAATGAGTGTTGAATTTCCAGGGATAAATGT
rJMSF001A05+ GAAGAGTGATCCAGAGCCACCACCTAAGAAAATGAGTGTTGAATTTCCAGGGATAAATGT
rJMSF040M11+ GAAGAGTGATCCAGAGCCACCACCTAAGAAAATGAGTGTTGAATTTCCAGGGATAAATGT
                      ____________________________________________________________
consensus GAAGAGTGATCCAGAGCCACCACCTAAGAAAATGAGTGTTGAATTTCCAGGGATAAATGT
 
. : . : . : . : . : . :
rJMSF026E10+ CCCGATACCAGAGGATGCAGATAAATGGCGTTGGGCAGCAGGGTCATCAAGTTGGAAAAT
rJMSF001A05+ CCCGATACCAGAGGATGCAGATAAATGGCGTTGGGCAGCAGGGTCATCAAGTTGGAAAAT
rJMSF040M11+ CCCGATACCAGAGGATGCAGATAAATGGCGTTGGGCAGCAGGGTCATCAAGTTGGAAAAT
                      ____________________________________________________________
consensus CCCGATACCAGAGGATGCAGATAAATGGCGTTGGGCAGCAGGGTCATCAAGTTGGAAAAT
 
. : . : . : . : . : . :
rJMSF026E10+ TTCAAGAACTTCCTCATACAGTAGGCATAACCATACATCAGACAGAGAGCATTATCTTGA
rJMSF001A05+ TTCAAGAACTTCCTCATACAGTAGGCATAACCATACATCAGACAGAGAGCATTATCTTGA
rJMSF040M11+ TTCAAGAACTTCCTCATACAGTAGGCATAACCATACATCAGACAGAGAGCATTATCTTGA
                      ____________________________________________________________
consensus TTCAAGAACTTCCTCATACAGTAGGCATAACCATACATCAGACAGAGAGCATTATCTTGA
 
. : . : . : . : . : . :
rJMSF026E10+ ACGACAAATGTCCAGGGATTTCCAAGACGAAGGGCATGATCGTAGAACAGAAACTATCAA
rJMSF001A05+ ACGACAAATGTCCAGGGATTTCCAAGACGAAGGGCATGATCGTAGAACAGAAACTATCAA
rJMSF040M11+ ACGACAAATGTCCAGGGATTTCCAAGACGAAGGGCATGATCGTAGAACAGAAACTATCAA
                      ____________________________________________________________
consensus ACGACAAATGTCCAGGGATTTCCAAGACGAAGGGCATGATCGTAGAACAGAAACTATCAA
 
. : . : . : . : . : . :
rJMSF026E10+ CAGAGGGCATTATCACGAAAAATCGCCTGGCGATTTTGAGGACGAAGGCCCTCCTGGCTG
rJMSF001A05+ CAGAGGGCATTATCACGAAAAATCGCCTGGCGATTTTGAGGACGAAGGCCCTCCTGGCTG
rJMSF040M11+ CAGAGGGCATTATCACGAAAAATCGCCTGGCGATTTTGAGGACGAAGGCCCTCCTGGCTG
                      ____________________________________________________________
consensus CAGAGGGCATTATCACGAAAAATCGCCTGGCGATTTTGAGGACGAAGGCCCTCCTGGCTG
 
. : . : . : . : . : . :
rJMSF026E10+ TGGACATGACCCTGGTATGAGCCCCTCTCTATCTCACAGATTCAGAGGCCACGACTCCAA
rJMSF001A05+ TGGACATGACCCTGGTATGAGCCCCTCTCTATCTCACAGATTCAGAGGCCACGACTCCAA
rJMSF040M11+ TGGACATGACCCTGGTATGAGCCCCTCTCTATCTCACAGATTCAGAGGCCACGACTCCAA
                      ____________________________________________________________
consensus TGGACATGACCCTGGTATGAGCCCCTCTCTATCTCACAGATTCAGAGGCCACGACTCCAA
 
. : . : . : . : . : . :
rJMSF026E10+ TTTTAGTTCTCCAAGTCCCAGGGATGGTTCTTCAGCATCAAAATCCCATAGTTATGGAAG
rJMSF001A05+ TTTTAGTTCTCCAAGTCCCAGGGATGGTTCTTCAGCATCAAAATCCCATAGTTATGGAAG
rJMSF040M11+ TTTTAGTTCGCCAAGTCCCAGGGATGGTTCTTCAGCATCAAAATCCCATAGTTATGGAAG
                      ____________________________________________________________
consensus TTTTAGTTCTCCAAGTCCCAGGGATGGTTCTTCAGCATCAAAATCCCATAGTTATGGAAG
 
. : . : . : . : . : . :
rJMSF026E10+ ATCCTCGTCGGACAGGGGCAGAAGAAGCCCACTTGTCCATGACAGTTCTTCAAACCACAG
rJMSF001A05+ ATCCTCGTCGGACAGGGGCAGAAGAAGCCCACTTGTCCATGACAGTTCTTCAAACCACAG
rJMSF040M11+ ATCCTCATCGGACAGGGGCAGAAGAAGCCCACTTGTCCATGACAGTTCTTCAAACCACAG
                      ____________________________________________________________
consensus ATCCTCGTCGGACAGGGGCAGAAGAAGCCCACTTGTCCATGACAGTTCTTCAAACCACAG
 
. : . : . : . : . : . :
rJMSF026E10+ TTCATACCCAAGATGACTATTATTCACTAATTTCCTCACACCACCTCCAATGGTGGTGAA
rJMSF001A05+ TTCATACCCAAGATGACTATTATTCACTAATTTCCTCACACCACCTCCAATGGTGGTGAA
rJMSF040M11+ TTCATACCCAAGATGACTATTATTCACTAATTTCCTCACACCACCTCCAATGGTGGTGAA
                      ____________________________________________________________
consensus TTCATACCCAAGATGACTATTATTCACTAATTTCCTCACACCACCTCCAATGGTGGTGAA
 
. : . : . : . : . : . :
rJMSF026E10+ TGAAATGAGAAGATAATGGATGTCTCTATAATTTTTTGTTTTCAAGATGTTAGTTCCTCA
rJMSF001A05+ TGAAATGAGAAGATAATGGATGTCTCTATAATTTTTTGTTTTCAAGATGTTAGTTCCTCA
rJMSF040M11+ TGAAATGAGAAGATAATGGATGTCTCTATAATTTTTTGTTTTCAAGATGTTAGTTCCTCA
                      ____________________________________________________________
consensus TGAAATGAGAAGATAATGGATGTCTCTATAATTTTTTGTTTTCAAGATGTTAGTTCCTCA
 
. : . : . : . : . : . :
rJMSF026E10+ TGGCTGTACATAAATTAGACATGAGAGGAAATTAGATGGATATGTGACTTTCATTTAATG
rJMSF001A05+ TGGCTGTACATAAATTAGACATGAGAGGAAATTAGATGGATATGTGACTTTCATTTAATG
rJMSF040M11+ TGGCTGTACATAAATTAGACATGAGAGGAAATTAGATGGATATGTGACTTTCATTTAATG
                      ____________________________________________________________
consensus TGGCTGTACATAAATTAGACATGAGAGGAAATTAGATGGATATGTGACTTTCATTTAATG
 
. : . : . : . : . : . :
rJMSF026E10+ AAGATTTTGTAATAATTAAAGTTTGTTTCTCATATGACTC--TATACATTTCATCTT
rJMSF001A05+ AAGATTTTGTAATAATTAAAGTTTGTTTCTCATATGACTC--TATACATTTCATCTT
rJMSF040M11+ AAGATTTTGTAATAATTAAAGTTTGTTTCTCATAAGACTCTGTATACATTTCATCTTTCT
                      ____________________________________________________________
consensus AAGATTTTGTAATAATTAAAGTTTGTTTCTCATATGACTC--TATACATTTCATCTTTCT