Previous Contig 013303:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF018J02Sequence504013303 (6)gb:BT010908_16408547e-19Arabidopsis thaliana At4g13870 mRNA, complete cds.>gb:AF531179_1809280 Arabidops745013303 (6)gb:OSJN00161_16959314e-12Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0027H09, complete seque
JMSF036D02Sequence693013303 (6)pir|T05256|T052561e-34hypothetical protein F18A5.260 - Arabidopsis thaliana>gb:ATCHRIV37_1545151 Arabi714013303 (6)gb:BT010908_16408547e-42Arabidopsis thaliana At4g13870 mRNA, complete cds.>gb:AF531179_1809280 Arabidops
JMSF040K02Sequence671013303 (6)gb:BT010908_16408545e-38Arabidopsis thaliana At4g13870 mRNA, complete cds.>gb:AF531179_1809280 Arabidops753013303 (6)gb:BT010908_16408545e-25Arabidopsis thaliana At4g13870 mRNA, complete cds.>gb:AF531179_1809280 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040K02- GCGC
JMSF036D02- GGGAGAGGCCAACTAGGCGCGC
                      ____________________________________________________________
consensus GGGAGAGGCCAACTAGGCGCGC
 
. : . : . : . : . : . :
JMSF040K02- ACCACTGAACTGAATCTCCGCCTCTCCGGGAAGAAATGGAAACATCAGTCCCTTCATCGA
JMSF036D02- ACCACTGAACTGAATCTCCGCCTCTCCGGGAAGAAATGGAAACATCAGTCCCTTCATCGA
                      ____________________________________________________________
consensus ACCACTGAACTGAATCTCCGCCTCTCCGGGAAGAAATGGAAACATCAGTCCCTTCATCGA
 
. : . : . : . : . : . :
JMSF018J02- ACTGGGATCGTCCTTTCACTGATCTAGAGCTCCTAGAAATCGAAG
JMSF040K02- TGGCCGGTTTAGACGACTGGGATCGTCCTTTCACTGATCTAGAGCTCCTAGAAATCGAAG
JMSF036D02- TGGCCGGTTTAGACGACTGGGATCGTCCTTTCACTGATCTAGAGCTCCTAGAAATCGAAG
                      ____________________________________________________________
consensus TGGCCGGTTTAGACGACTGGGATCGTCCTTTCACTGATCTAGAGCTCCTAGAAATCGAAG
 
. : . : . : . : . : . :
JMSF018J02- CAGCTTTTCAATCTGCCACCAACAAGCGCAAAGATTCCGATAAGTCCTCCGCTCCCGCTG
JMSF040K02- CAGCTTTTCAATCTGCCACCAACAAGCGCAAAGATTCCGATAAGTCCTCCGCTCCCGCTG
JMSF036D02- CAGCTTTTCAATCTGCCACCAACAAGCGCAAAGATTCCGATAAGTCCTCCGCTCCCGCTG
                      ____________________________________________________________
consensus CAGCTTTTCAATCTGCCACCAACAAGCGCAAAGATTCCGATAAGTCCTCCGCTCCCGCTG
 
. : . : . : . : . : . :
JMSF018J02- CCGAAGATGAGGTTAACGGCGATGTAAATAAATTTCGCCGGAACCATCGCCGGAGACTGC
JMSF040K02- CCGAAGATGAGGTTAACGGCGATGTAAATAAATTTCGCCGGAACCATCGCCGGAGACTGC
JMSF036D02- CCGAAGATGAGGTTAACGGCGATGTAAATAAATTTCGCCGGAACCATCGCCGGAGACTGC
                      ____________________________________________________________
consensus CCGAAGATGAGGTTAACGGCGATGTAAATAAATTTCGCCGGAACCATCGCCGGAGACTGC
 
. : . : . : . : . : . :
JMSF018J02- CTGCATCACTCTTCTCCACTTCTTTTTCCCTGTCCCCATGCCCTAGAAGTCGATTTAAGC
JMSF040K02- CTGCATCACTCTTCTCCACTTCTTTTTCCCTGTCCCCATGCCCTAGAAGTCGATTTAAGC
JMSF036D02- CTGCATCACTCTTCTCCACTTCTTTTTCCCTGTCCCCATGCCCTA-AAGTCGATTTAAGC
                      ____________________________________________________________
consensus CTGCATCACTCTTCTCCACTTCTTTTTCCCTGTCCCCATGCCCTAGAAGTCGATTTAAGC
 
. : . : . : . : . : . :
JMSF018J02- ATCAATTGAATAGGTTCCCAGCACTAGCATTCAGGGGGCGTATTGTATATAGCAGAACTG
JMSF040K02- ATCAATTGAATAGGTTCCCAGCACTAGCATTCAGGGGGCGTATTGTATATAGCAGAACTG
JMSF036D02- ATCAATTGAATAGGTTCCCAGCACTAGCATTCAGGGGGCGTATTGTATATAGCAGAACTG
                      ____________________________________________________________
consensus ATCAATTGAATAGGTTCCCAGCACTAGCATTCAGGGGGCGTATTGTATATAGCAGAACTG
 
. : . : . : . : . : . :
JMSF018J02- CAGTTGAGGCCGAGAGATCTGCAGCAGAGCTTTTAAATTTTATTGAAACGAGGAAGAGAG
JMSF040K02- CAGTTGAGGCCGAGAGATCTGCAGCAGAGCTTTTAAATTTTATTGAAACGAGGAAGAGAG
JMSF036D02- CAGTTGAGGCCGAGAGATCTGCAGCAGAGCTTTTAAATTTTATTGAAACGAGGAAGAGAG
                      ____________________________________________________________
consensus CAGTTGAGGCCGAGAGATCTGCAGCAGAGCTTTTAAATTTTATTGAAACGAGGAAGAGAG
 
. : . : . : . : . : . :
JMSF018J02- CAGAAGGTGTAGTTGCTCTGGGATTTGACATTGAATGGAAACCCACTTTCAAAAGAGGTG
JMSF040K02- CAGAAGGTGTAGTTGCTCTGGGATTTGACATTGAATGGAAACCCACTTTCAAAAGAGGTG
JMSF036D02- CAGAAGGTGTAGTTGCTCTGGGATTTGACATTGAATGGAAACCCACTTTCAAAAGAGGTG
                      ____________________________________________________________
consensus CAGAAGGTGTAGTTGCTCTGGGATTTGACATTGAATGGAAACCCACTTTCAAAAGAGGTG
 
. : . : . : . : . : . :
JMSF018J02- TTGCCCCCTGGGAAAGCGGCTGTTATGCAGATATGTGGGGAGATGAACCGTTGTTATGTC
JMSF040K02- TTG-CCCCTGGGAAAGCGGCTGTTATGCAGATATGTGGGGAGATGAACCGTTGTTATGTC
JMSF036D02- TTG-CCCCTGGGAAAGCGGCTGTTATGCAGATATGTGGGGAGATGAACCGTTGTTATGTC
rJMSF036D02+ TTATGCAGATATGTGGGGAGATGAACCGTTGTTATGTC
                      ____________________________________________________________
consensus TTG-CCCCTGGGAAAGCGGCTGTTATGCAGATATGTGGGGAGATGAACCGTTGTTATGTC
 
. : . : . : . : . : . :
JMSF018J02- TTCCACATATTCCATTCTGGAATCCCTCAAAATCTGCAG
JMSF040K02- TTCCACATATTCCATTCTGGAATCCCTCAAAATCTGCAGACACTTCTAGGGAATTCTGCT
JMSF036D02- TTCCACATATTCCATTCTGGAATCCCTCAAAATCTGCAGACACTTCTAGGGAATTCTGCT
rJMSF036D02+ TTCCACATATTCCATTCTGGAATCCCTCAAAATCTGCAGACACTTCTAGGGAATTCTGCT
                      ____________________________________________________________
consensus TTCCACATATTCCATTCTGGAATCCCTCAAAATCTGCAGACACTTCTAGGGAATTCTGCT
 
. : . : . : . : . : . :
JMSF040K02- ACTGTGAAGGTGGGAGTAAGCATCGCGGGTGATGCTCATAAGGNTTTTCTAGATCATAAT
JMSF036D02- ACTGTGAAGGTGGGAGTAAGCATCGCGGGTGATGCTCATAAGGNTTTTCTAGATCATAAT
rJMSF036D02+ ACTGTGAAGGTGGGAGTAAGCATCGCGGGTGATGCTCATAAGGTTTTTCTAGATCATAAT
                      ____________________________________________________________
consensus ACTGTGAAGGTGGGAGTAAGCATCGCGGGTGATGCTCATAAGGTTTTTCTAGATCATAAT
 
. : . : . : . : . : . :
JMSF040K02- GTACCTG
JMSF036D02- GTACCTG
rJMSF036D02+ GTACCTGTTAGAAATGTGGATGATCTATCTGCGCTAGCCAATCTAAAGATTGGTGGAGTT
                      ____________________________________________________________
consensus GTACCTGTTAGAAATGTGGATGATCTATCTGCGCTAGCCAATCTAAAGATTGGTGGAGTT
 
. : . : . : . : . : . :
rJMSF036D02+ CCCAAAAATTGGAGTCTAGCATCATTGACAGAAACACTCCTTTGCAAACAGCTCCCTAAG
rJMSF018J02+ AGCTCCCTAAG
rJMSF040K02+ AGCTCCCTAAG
                      ____________________________________________________________
consensus CCCAAAAATTGGAGTCTAGCATCATTGACAGAAACACTCCTTTGCAAACAGCTCCCTAAG
 
. : . : . : . : . : . :
rJMSF036D02+ CCAAACCATATAAGATTGGGAAATTGGGAGACTCCAGTTTTATCAAAAGAACACCTAAAT
rJMSF018J02+ CCAAACCATATAAGATTGGGAAATTGGGAGACTCCAGTTTTATCAAAAGAACACCTAAAT
rJMSF040K02+ CCAAACCATATAAGATTGGGAAATTGGGAGACTCCAGTTTTATCAAAAGAACACCTNAAT
                      ____________________________________________________________
consensus CCAAACCATATAAGATTGGGAAATTGGGAGACTCCAGTTTTATCAAAAGAACACCTAAAT
 
. : . : . : . : . : . :
rJMSF036D02+ TATGCTGCCACAGATGCTTTTGTTTCATGGCACCTATATCAGGCGTTGAAGAGCCTTCCT
rJMSF018J02+ TATGCTGCCACAGATGCTTTTGTTTCATGGCACCTATATCAGGCGTTGAAGAGCCTTCCT
rJMSF040K02+ TATGCTGCCACAGATGCTTTTGTTTCANGGCACCTATATCAGGCGTTGAAGAGCCTTCCT
                      ____________________________________________________________
consensus TATGCTGCCACAGATGCTTTTGTTTCATGGCACCTATATCAGGCGTTGAAGAGCCTTCCT
 
. : . : . : . : . : . :
rJMSF036D02+ GAGGCTGTTGATAATAAGAGCAACGAACCAGAGCATGTGAGCAGTGAGTGAGATGTGATT
rJMSF018J02+ GAGGCTGTTGATAATAAGAGCAACGAACCAGAGCATGTGAGCAGTGAGTGAGATGTGATT
rJMSF040K02+ GAGGCTGTNGATAATAAGAGCAACGAACCAGAGCANGTGAGCAGTGAGTGAGANGTGATT
                      ____________________________________________________________
consensus GAGGCTGTTGATAATAAGAGCAACGAACCAGAGCATGTGAGCAGTGAGTGAGATGTGATT
 
. : . : . : . : . : . :
rJMSF036D02+ GTCAACTATTGTTTGAATAGTAGTGGCGGCTGTAACATCAGTTACATCTGGACTATTAAA
rJMSF018J02+ GTCAACTATTGTTTGAATAGTAGTGGCGGCTGTAACATCAGTTACATCTGGACTATTAAA
rJMSF040K02+ GTCAACTATTGTTTGAATTGTAGTGGCGGCTGTAACATCAGTTACATCTGGANTATTAAA
                      ____________________________________________________________
consensus GTCAACTATTGTTTGAATAGTAGTGGCGGCTGTAACATCAGTTACATCTGGACTATTAAA
 
. : . : . : . : . : . :
rJMSF036D02+ TTTCGCGCTTATCTGGTCCAGTCCAAGTGTCCAACCATCTTGCTTGATGCTGTTATATAT
rJMSF018J02+ TTTCGCGCTTATCTGGTCCAGTCCAAGTGTCCAACCATCTTGCTTGATGCTGTTATATAT
rJMSF040K02+ TTTCGCGCTNATCTGGTCCAGTCCAAGTGTCCAACCATCTTGCTTGATGCTGTTATATAT
                      ____________________________________________________________
consensus TTTCGCGCTTATCTGGTCCAGTCCAAGTGTCCAACCATCTTGCTTGATGCTGTTATATAT
 
. : . : . : . : . : . :
rJMSF036D02+ CCATTTGCTCTAGCCAAACCTTTTCTTATCCAGAGGCACAAGTCACTGCTAATGAGGTAC
rJMSF018J02+ CCATTTGCTCTAGCCAAACCTTTTCTTATCCAGAGGCACAAGTCACTGCTAATGAGGTAC
rJMSF040K02+ CCATTNGCTCTAGCCAAACCTTTTCTTATCCAGAGGCACAAGTCACTGCTANTGAGGTAC
                      ____________________________________________________________
consensus CCATTTGCTCTAGCCAAACCTTTTCTTATCCAGAGGCACAAGTCACTGCTAATGAGGTAC
 
. : . : . : . : . : . :
rJMSF036D02+ TTTTAGCTAGTGCAGTGCATCCTGAACCTTATTGGAGGAGTGTTATCAGCTTCTCAGTCT
rJMSF018J02+ TTTTAGCTAGTGCAGTGCATCCTGAACCTTATTGGAGGAGTGTTATCAGCTTCTCAGTCT
rJMSF040K02+ TTTTAGCTAGNGCAGNGCATCCTGAACCTTATTGGAGGAGTGTTATCAGCTTCTCAGTCN
                      ____________________________________________________________
consensus TTTTAGCTAGTGCAGTGCATCCTGAACCTTATTGGAGGAGTGTTATCAGCTTCTCAGTCT
 
. : . : . : . : . : . :
rJMSF036D02+ GGATCATATTACTGAA
rJMSF018J02+ GGATCATATTACTGAATTAGTTCATAGCTATTCGTTTGGTTAAAGTTATTCTTCTGTGAT
rJMSF040K02+ GGATCATATTACTGAANTAGTTCATAGCTATTCGTTTGGTTAAAGTTATTCTTCTGTGAT
                      ____________________________________________________________
consensus GGATCATATTACTGAATTAGTTCATAGCTATTCGTTTGGTTAAAGTTATTCTTCTGTGAT
 
. : . : . : . : . : . :
rJMSF018J02+ AAGAAATGGTGTTCT-TTGGTTTTTACCCATCTTTCTCTCTTGAAATCAATGTTGAGAAA
rJMSF040K02+ AAGAAATGGTGTTCTATTGGTTTNTACCCATCTTTCTCTCTTGAAATCAATGTTGAGAAA
                      ____________________________________________________________
consensus AAGAAATGGTGTTCTATTGGTTTTTACCCATCTTTCTCTCTTGAAATCAATGTTGAGAAA
 
. : . : . : . : . : . :
rJMSF018J02+ TTGAGTCTTTTCTT-CTATGCTGTGATATGT
rJMSF040K02+ TTGAGTCTTTTCTTCCTATGCTGTGATATGTTNCTGAATTTGCTGCCCCCTGCAAAAAGA
                      ____________________________________________________________
consensus TTGAGTCTTTTCTTCCTATGCTGTGATATGTTNCTGAATTTGCTGCCCCCTGCAAAAAGA