Previous Contig 013294:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF040I18Sequence822013294 (2)
JMSF048C09Sequence682007531 (5)gb:AK176104_18180922e-55Arabidopsis thaliana mRNA for putative protein, complete cds, clone: RAFL22-88-O697013294 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040I18+ GTTTGAGGATATTGACAGTCCATGNACAATGGAAAGAANCTG
                      ____________________________________________________________
consensus GTTTGAGGATATTGACAGTCCATGNACAATGGAAAGAANCTG
 
. : . : . : . : . : . :
rJMSF040I18+ CCTTANTAACATGCTTTTGGNGTCTTGGTAGTTTCTTTTCTNGGTAAGCTCTGAACTACA
                      ____________________________________________________________
consensus CCTTANTAACATGCTTTTGGNGTCTTGGTAGTTTCTTTTCTNGGTAAGCTCTGAACTACA
 
. : . : . : . : . : . :
rJMSF048C09+ TTTCATAAAGCATGACTGTTTGTAAAAATCTGATAACCATG
rJMSF040I18+ GAAATTTTTTTTCTNTTCATTTCATAAAGCATGNCTGTTTGTAAAAATCTGATAACCATG
                      ____________________________________________________________
consensus GAAATTTTTTTTCTNTTCATTTCATAAAGCATGACTGTTTGTAAAAATCTGATAACCATG
 
. : . : . : . : . : . :
rJMSF048C09+ TATGAATTAATCCTTAAATAGGATTTTTATCGGTATTTGATAGTCTTCCAGTCCTCCCCA
rJMSF040I18+ TATGAANTAATCCTTAAATAGGATTTTGATCGGTATTTGATAGTCTTCCAGTCCTCCCCA
                      ____________________________________________________________
consensus TATGAATTAATCCTTAAATAGGATTTTTATCGGTATTTGATAGTCTTCCAGTCCTCCCCA
 
. : . : . : . : . : . :
rJMSF048C09+ TTAACATAAGAAATATAGTTGGTATATAGAGTTGTAGAGAGATTACACTCAAATCTCAAT
rJMSF040I18+ TTAACATAAGAAATATAGTTGGTATATAGAGTTGTAGAGAGATTACACTCAAATCTCAAT
                      ____________________________________________________________
consensus TTAACATAAGAAATATAGTTGGTATATAGAGTTGTAGAGAGATTACACTCAAATCTCAAT
 
. : . : . : . : . : . :
rJMSF048C09+ ACATAGCTGCTCATGGTACCTTTAGTTATGTCATACTCTTTGAAGTCTGTGATTGTATCA
rJMSF040I18+ ACATAGCTGCTCATGGTACCTTTAGNTATGTCATACTCTTTGAAGTCTGNGATTGTATCA
                      ____________________________________________________________
consensus ACATAGCTGCTCATGGTACCTTTAGTTATGTCATACTCTTTGAAGTCTGTGATTGTATCA
 
. : . : . : . : . : . :
rJMSF048C09+ GAGATTAGGTCATTCATATGACATAACAAGCACAATAAATGCCTGGATAACTAGCTACTT
rJMSF040I18+ GAGATTAGGTCATTCATANGACATAACAAGCACAATAAATGCCTGGATAACTAGCTACTN
                      ____________________________________________________________
consensus GAGATTAGGTCATTCATATGACATAACAAGCACAATAAATGCCTGGATAACTAGCTACTT
 
. : . : . : . : . : . :
rJMSF048C09+ GCTTCTAACTTCTTCCTTACTTATTTTCTTGCAGGTACCGTAATTCTTTTCTCTACTCCT
rJMSF040I18+ GNTTCTAACTTCTTCCTTACTTATTTTCTTGCAGGTACCGTAATTCTTTTCTCTACTCTT
                      ____________________________________________________________
consensus GCTTCTAACTTCTTCCTTACTTATTTTCTTGCAGGTACCGTAATTCTTTTCTCTACTCTT
 
. : . : . : . : . : . :
rJMSF048C09+ TCCAGCTAGACGATTTTTCTTCCCATTGTCTTGGTGGTGAACTGTAGTACATCAGAACAG
rJMSF040I18+ TCCAGCTAGACGATTTTTCTTCCCATTGTCTTGGTGGTGAACTGTAGTACATCNGAACAG
                      ____________________________________________________________
consensus TCCAGCTAGACGATTTTTCTTCCCATTGTCTTGGTGGTGAACTGTAGTACATCAGAACAG
 
. : . : . : . : . : . :
rJMSF048C09+ CTTAGCTTAAAATACAAATAGGATGCACCTCGTCCGTCGGTAATATTACCACCTTTTGAC
rJMSF040I18+ CTTAGCTTAAAATACAAATAGGATGCACCTCGTCCGTCGGTAATATTACCACCTTTNGAC
                      ____________________________________________________________
consensus CTTAGCTTAAAATACAAATAGGATGCACCTCGTCCGTCGGTAATATTACCACCTTTTGAC
 
. : . : . : . : . : . :
rJMSF048C09+ ATAGCAGGGGATCCCTCTTAGTTTGTTCAGAAGTCCCCTTTTGCCTCTAGGCATATTACG
rJMSF040I18+ ATAGCAGGGGATCCCTCTTAGTTTGTTCAGAAGTCCCCTTTTGCCTCTAGGCATATTACG
                      ____________________________________________________________
consensus ATAGCAGGGGATCCCTCTTAGTTTGTTCAGAAGTCCCCTTTTGCCTCTAGGCATATTACG
 
. : . : . : . : . : . :
rJMSF048C09+ AGGGAGGCAACATCATGTATATTTTGTCATACAGTTTCAGATACCGATATATAAATATAA
rJMSF040I18+ AGGGAGGCAACATCATGTATATTTTGTCATACAGTTTCAGATACCGATATATAAATATAA
                      ____________________________________________________________
consensus AGGGAGGCAACATCATGTATATTTTGTCATACAGTTTCAGATACCGATATATAAATATAA
 
. : . : . : . : . : . :
rJMSF048C09+ ATGTTTTAGTGGAGTTTATTTCTCGAGCTAGTAGTCACTCACCTTGTGTA-CAAATTTCT
rJMSF040I18+ ATGTTTTAGTGGAGTTTATTTCTCGAGCTNGTAGTCACTCACCNTGTGTATCAAATTTCN
                      ____________________________________________________________
consensus ATGTTTTAGTGGAGTTTATTTCTCGAGCTAGTAGTCACTCACCTTGTGTATCAAATTTCT
 
. : . : . : . : . : . :
rJMSF048C09+ TGTCGTGTAAAGAACA
rJMSF040I18+ CGTCGNGTAAAGAACAACAGTNTAAAGATGGGANTGTGGNCCAGGTNTGAGAAAAAAAAA
                      ____________________________________________________________
consensus TGTCGTGTAAAGAACAACAGTNTAAAGATGGGANTGTGGNCCAGGTNTGAGAAAAAAAAA