Previous Contig 013293:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF040I16Sequence686020067pir|A96842|A968422e-82F23A5.27 [imported] - Arabidopsis thaliana>gb:AE005173_895604 Arabidopsis thalia849013293 (2)gb:AP003898_18349542e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ16
JMSF051D04Sequence629020559733013293 (2)gb:AP003898_18349548e-30Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ16

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040I16+ AAGTTGAGG
                      ____________________________________________________________
consensus AAGTTGAGG
 
. : . : . : . : . : . :
rJMSF040I16+ AGAAATTATCACGAGGGATGGGGTGGTGAGAATGCATATCATGTGAGTGGGTACCGCTAT
                      ____________________________________________________________
consensus AGAAATTATCACGAGGGATGGGGTGGTGAGAATGCATATCATGTGAGTGGGTACCGCTAT
 
. : . : . : . : . : . :
rJMSF051D04+ GGGAAAAGTAACAACT
rJMSF040I16+ TTGCTGGTAGACAGTGATAGATATATCTCTAGAGCTTCTCCGACGGGAAAAGTAACAACT
                      ____________________________________________________________
consensus TTGCTGGTAGACAGTGATAGATATATCTCTAGAGCTTCTCCGACGGGAAAAGTAACAACT
 
. : . : . : . : . : . :
rJMSF051D04+ CTGACAAAGGATTCTTTAATTGCACTGACTAAGCTTCGAGAAGAGGTTGATTTGGAAAGA
rJMSF040I16+ CTGACAAAGGATTCTTTAATTGCACTGACTAAGCTTCGAGAAGAGGTTGATTTGGAAAGA
                      ____________________________________________________________
consensus CTGACAAAGGATTCTTTAATTGCACTGACTAAGCTTCGAGAAGAGGTTGATTTGGAAAGA
 
. : . : . : . : . : . :
rJMSF051D04+ AACAGAGCAAAGTGTGATGTTTCTGGCAATGAAAAAGATCAAGAAATATGTATCAGAGCC
rJMSF040I16+ AACAGAGCAAAGTGTGATGTTTCTGGCAATGAAAAAGATCAAGAAATATGTATCAGAGCC
                      ____________________________________________________________
consensus AACAGAGCAAAGTGTGATGTTTCTGGCAATGAAAAAGATCAAGAAATATGTATCAGAGCC
 
. : . : . : . : . : . :
rJMSF051D04+ AAAAACAATGCTTGGGTGATTGCTAGGCTAACAAGAGGGAAGGTTCTTTTCATGGTTCTT
rJMSF040I16+ AAAAACAATGCTTGTGTGATTGCTAGGCTAACAAGAGGGAAGGTTCTTTTCATGGTTCTT
                      ____________________________________________________________
consensus AAAAACAATGCTTGTGTGATTGCTAGGCTAACAAGAGGGAAGGTTCTTTTCATGGTTCTT
 
. : . : . : . : . : . :
rJMSF051D04+ GAGAAGGCCAATGAGACACTTCTCTATGCCAATGATACTGTTGAGAAATTCAGTGACAGG
rJMSF040I16+ GAGAAGGCCAATGAGACACTTCTCTATGCCAATGATACTGTTGAGAAATTCAGTGACAGG
                      ____________________________________________________________
consensus GAGAAGGCCAATGAGACACTTCTCTATGCCAATGATACTGTTGAGAAATTCAGTGACAGG
 
. : . : . : . : . : . :
rJMSF051D04+ TATTGCAATGGAGCTTTTTCCCTGGGGTGATGATTATCATCTTTAGTTTTCGTACTCATA
rJMSF040I16+ TATTGCAATGGAGCTTTTTCCCTGGGGTGATGATTATCATCTTTAGTTTTCGTACTCATA
                      ____________________________________________________________
consensus TATTGCAATGGAGCTTTTTCCCTGGGGTGATGATTATCATCTTTAGTTTTCGTACTCATA
 
. : . : . : . : . : . :
rJMSF051D04+ TGAAGGAGAGACACTTGGAACACTTGTTTTAACTTAGGCACTTAAATGTTATACTTGGTG
rJMSF040I16+ TGAAGGAGAGACACTTGGAACACTTGTTTTAACTTAGGCACTTAAATGTTATACTTGGTG
                      ____________________________________________________________
consensus TGAAGGAGAGACACTTGGAACACTTGTTTTAACTTAGGCACTTAAATGTTATACTTGGTG
 
. : . : . : . : . : . :
rJMSF051D04+ CTCTGATAATATGAGATTGGTGACAAAGGAATATACCCCCGAATATGCTTCTAGTACTGC
rJMSF040I16+ CTCTGATAATATGAGATTGGTGACAAAGGAATATACCCCCGAATATGCTTCTAGTACTGC
                      ____________________________________________________________
consensus CTCTGATAATATGAGATTGGTGACAAAGGAATATACCCCCGAATATGCTTCTAGTACTGC
 
. : . : . : . : . : . :
rJMSF051D04+ CTATGATTTGGAGAATGGTTGGACTGGCTCCAATCAGTTGGAAAGGGATTTGATATTACA
rJMSF040I16+ CTATGATTTGGAGAATGGTTGGACTGGCTCCAATCAGTTGGAAAGGGATTTGATATTACA
                      ____________________________________________________________
consensus CTATGATTTGGAGAATGGTTGGACTGGCTCCAATCAGTTGGAAAGGGATTTGATATTACA
 
. : . : . : . : . : . :
rJMSF051D04+ ACTGCCATAAAGTATATTGTACACGTTCGCAAATATGTTGATCATCTTCAGGTTGAGTTT
rJMSF040I16+ ACTGCCATAAAGTATATTGTACACGTTCGCAAATATGTTGATCATCTTCAGGTTGAGTTT
                      ____________________________________________________________
consensus ACTGCCATAAAGTATATTGTACACGTTCGCAAATATGTTGATCATCTTCAGGTTGAGTTT
 
. : . : . : . : . : . :
rJMSF051D04+ TACAAAGGTAGCAATGCTGGAACACCATGCTATGCTATATTCCATGTATTAACCTAATTG
rJMSF040I16+ TACAAAGGTAGCAATGCTGGAACACCATGCTATGCTATATTCCATGTATTAACCTAATTG
                      ____________________________________________________________
consensus TACAAAGGTAGCAATGCTGGAACACCATGCTATGCTATATTCCATGTATTAACCTAATTG
 
. : . : . : . : . : . :
rJMSF051D04+ TACACTAGCTTTCCTTTTTGCCTCTTTGTGATTTCTTGGAAGAGGTTAAATTAAGAACAT
rJMSF040I16+ TACACTAGCTTTCCTTTTTGCCTCTTTGTGATTTCTTGGAAGAGGTTAAATTAAGAACAT
                      ____________________________________________________________
consensus TACACTAGCTTTCCTTTTTGCCTCTTTGTGATTTCTTGGAAGAGGTTAAATTAAGAACAT
 
. : . : . : . : . : . :
rJMSF051D04+ GACACTCTTGTGAATGTACAGATATCTAGATTATTCTATGTA-CTTGAGGACAAATCT
rJMSF040I16+ GACACTCTTGTGAATGTACAGATATCTAGATTATTCTATGTACCTTGAGGACAAATCTCA
                      ____________________________________________________________
consensus GACACTCTTGTGAATGTACAGATATCTAGATTATTCTATGTACCTTGAGGACAAATCTCA