Previous Contig 013289:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF040I01Sequence589013289 (2)gb:AF211533_17773936e-21Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 146 (ACRE146) mRNA, complet731013289 (2)gb:AF211533_17773933e-20Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 146 (ACRE146) mRNA, complet

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040I01- GGTCC
                      ____________________________________________________________
consensus GGTCC
 
. : . : . : . : . : . :
JMSF040I01- TCTTCAATTCATTCCAAAATAAACCAAAAAAAGAAAACACAACACAACATCTCTCTCTCA
                      ____________________________________________________________
consensus TCTTCAATTCATTCCAAAATAAACCAAAAAAAGAAAACACAACACAACATCTCTCTCTCA
 
. : . : . : . : . : . :
JMSF040I01- CACACACAGAGCTAAAAACAAGAAAAAATGGAGATAGAACAAATAACCCCACAAATAGTT
                      ____________________________________________________________
consensus CACACACAGAGCTAAAAACAAGAAAAAATGGAGATAGAACAAATAACCCCACAAATAGTT
 
. : . : . : . : . : . :
JMSF040I01- GGCAAGAAACTATGGAACATTGTGAGGATAGTTTTCTACATGGTGAGGAAAGGCGTTTCG
                      ____________________________________________________________
consensus GGCAAGAAACTATGGAACATTGTGAGGATAGTTTTCTACATGGTGAGGAAAGGCGTTTCG
 
. : . : . : . : . : . :
JMSF040I01- AAGAGCAAGCTAATTCACCTTAACCTCCAACTCGCCCTTCAACTCATGCTAAAGCGAGGC
rJMSF040I01+ TAAAGCGAGGC
                      ____________________________________________________________
consensus AAGAGCAAGCTAATTCACCTTAACCTCCAACTCGCCCTTCAACTCATGCTAAAGCGAGGC
 
. : . : . : . : . : . :
JMSF040I01- AAACTCGCCGCCGGCAAGGCGCTGAGCCACCACTACTCCGCCCTCATCACCTGCCGCTCC
rJMSF040I01+ AAACTCGCCGCCGGCAAGGCGCTGAGCCACCANTACTCCGCCCTCATCACCTGCCGCTCC
                      ____________________________________________________________
consensus AAACTCGCCGCCGGCAAGGCGCTGAGCCACCACTACTCCGCCCTCATCACCTGCCGCTCC
 
. : . : . : . : . : . :
JMSF040I01- CACCACTCCGTCAGAGTCTTCACCGGCCACGCCCCGCACGACTACGAGTTCAGCTGCAGC
rJMSF040I01+ CACCACTCCGTCAGAGTNTTCACCGGCCACGCCCCGCACGACTACGAGTTCAGCTGCAGC
                      ____________________________________________________________
consensus CACCACTCCGTCAGAGTCTTCACCGGCCACGCCCCGCACGACTACGAGTTCAGCTGCAGC
 
. : . : . : . : . : . :
JMSF040I01- AACACCCCCGCCGCCTTGTTCCACCACCACGCCAGCAAGCGGAGCAGGAACCACCGCCGC
rJMSF040I01+ AACACCCCCGCCGCCTTGTTCCACCACCACGCCAGCAAGCGGAGCAGGAACCACCGCCGC
                      ____________________________________________________________
consensus AACACCCCCGCCGCCTTGTTCCACCACCACGCCAGCAAGCGGAGCAGGAACCACCGCCGC
 
. : . : . : . : . : . :
JMSF040I01- GAAAACAAGATCGACGCCGATGTTTTCCAGAGGGTTTTCGAGATGCTGAACGACCGTCCC
rJMSF040I01+ GAAAACAAGATNGACGCCGATGTTTTCCAGAGGGTTTTCGAGATGCTGAACGACCGTCCC
                      ____________________________________________________________
consensus GAAAACAAGATCGACGCCGATGTTTTCCAGAGGGTTTTCGAGATGCTGAACGACCGTCCC
 
. : . : . : . : . : . :
JMSF040I01- GAGGCGGCGGTTGATGGGTCTCCTTTCACGGCGCTGCCGGGGTTCGGGCGGACCCCCACG
rJMSF040I01+ GAGGCGGCGGTTGATGGGTCTCCTTTCACGGCGCTGCCGGGGTTCGGGCGGACCCCCACG
                      ____________________________________________________________
consensus GAGGCGGCGGTTGATGGGTCTCCTTTCACGGCGCTGCCGGGGTTCGGGCGGACCCCCACG
 
. : . : . : . : . : . :
JMSF040I01- GTGAGGCAGCTGCGAGTGACGGATTCGCCCTTCCCGTTGAAGGA
rJMSF040I01+ GTGAGGCAGCTGCGAGTGACGGATTCGCCCTTCCCGTTGAAGGATTCCGAGGAGATCAAC
                      ____________________________________________________________
consensus GTGAGGCAGCTGCGAGTGACGGATTCGCCCTTCCCGTTGAAGGATTCCGAGGAGATCAAC
 
. : . : . : . : . : . :
rJMSF040I01+ TCCCAGGTGGATATGGACGCCGAGGAGTTCATCAGGAAGTTCTATACACAATTGAATNTA
                      ____________________________________________________________
consensus TCCCAGGTGGATATGGACGCCGAGGAGTTCATCAGGAAGTTCTATACACAATTGAATNTA
 
. : . : . : . : . : . :
rJMSF040I01+ CAAAGCAAGAAAGCCGCTCTTGAATCTCCATCCCCATATCACATCAGAGCTCGATGAACA
                      ____________________________________________________________
consensus CAAAGCAAGAAAGCCGCTCTTGAATCTCCATCCCCATATCACATCAGAGCTCGATGAACA
 
. : . : . : . : . : . :
rJMSF040I01+ GAAAACTGAAACTNTGATCAAGAATNTCCGGTGAAGATGATGATGTGAATTACGACGAGG
                      ____________________________________________________________
consensus GAAAACTGAAACTNTGATCAAGAATNTCCGGTGAAGATGATGATGTGAATTACGACGAGG
 
. : . : . : . : . : . :
rJMSF040I01+ TTTTCCATGGTTCTCTTGCAACATTTGCAAACATGTCACACTGTTTTTCCATGGAAGATC
                      ____________________________________________________________
consensus TTTTCCATGGTTCTCTTGCAACATTTGCAAACATGTCACACTGTTTTTCCATGGAAGATC
 
. : . : . : . : . : . :
rJMSF040I01+ AAGATCACCTCAAACAAACCATCATNTTCAACAAAGTCACGTGCCTCCCACATGCCCTTA
                      ____________________________________________________________
consensus AAGATCACCTCAAACAAACCATCATNTTCAACAAAGTCACGTGCCTCCCACATGCCCTTA
 
. : . : . : . : . : . :
rJMSF040I01+ ATTTCGAGCAATTTCCACTTTTTTTTTTCTTTTCTTTTCCCCCCACTGAGACAGTGAGGG
                      ____________________________________________________________
consensus ATTTCGAGCAATTTCCACTTTTTTTTTTCTTTTCTTTTCCCCCCACTGAGACAGTGAGGG