Previous Contig 013278:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034F21Sequence573002686 (8)gb:AY180975_15875574e-74Lycopersicon esculentum succinyl CoA ligase beta subunit mRNA, complete cds; nuc716013278 (5)gb:AP004053_18369832e-91Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMFF035E17Sequence574002686 (8)gb:AY180975_15875571e-76Lycopersicon esculentum succinyl CoA ligase beta subunit mRNA, complete cds; nuc757013278 (5)gb:AP004053_18369833e-90Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMFF039I22Sequence557000025 (27)gb:AF492468_18049179e-42Nicotiana langsdorffii x Nicotiana sanderae nectarin III (NEC3) mRNA, complete c755013278 (5)gb:AP004053_18369831e-86Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ12
JMSF027F05Sequence646002686 (8)gb:AY180975_15875572e-92Lycopersicon esculentum succinyl CoA ligase beta subunit mRNA, complete cds; nuc764013278 (5)gb:AY180975_15875572e-99Lycopersicon esculentum succinyl CoA ligase beta subunit mRNA, complete cds; nuc
JMSF040F04Sequence677002686 (8)gb:AY180975_15875574e-91Lycopersicon esculentum succinyl CoA ligase beta subunit mRNA, complete cds; nuc916013278 (5)gb:AY180975_1587557e-109Lycopersicon esculentum succinyl CoA ligase beta subunit mRNA, complete cds; nuc

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040F04+ TTGCTGATAGAAATGA
                      ____________________________________________________________
consensus TTGCTGATAGAAATGA
 
. : . : . : . : . : . :
rJMSF027F05+ GTGACTGCACAATGTT
rJMSF040F04+ CTCAATTGAACAAGTCAAGAAGTTGTACAATCTTTTTTGTCAATGTGACTGCACAATGTT
                      ____________________________________________________________
consensus CTCAATTGAACAAGTCAAGAAGTTGTACAATCTTTTTTGTCAATGTGACTGCACAATGTT
 
. : . : . : . : . : . :
rJMFF034F21+ GATAAGAAGTTAGTAGCTGCTGATGCAAAACT
rJMSF027F05+ GGAGATCAATCCCCTTGCTGAAACTTCTGATAAGAAGTTAGTAGCTGCTGATGCAAAACT
rJMFF035E17+ ATAAGAAGTTAGTAGCTGCTGATGTAAAACT
rJMFF039I22+ GATAAGAAGTTAGTAGCTGCTGATGCAAAACT
rJMSF040F04+ GGAGATCAATCCCCTTGCTGAAACTTCTGATAAGAAGTTAGTAGCTGCTGATGCAAAACT
                      ____________________________________________________________
consensus GGAGATCAATCCCCTTGCTGAAACTTCTGATAAGAAGTTAGTAGCTGCTGATGCAAAACT
 
. : . : . : . : . : . :
rJMFF034F21+ GAACTTTGATGATAATGCTGCTTACCGTCAGAAAGAAATCTTTTCCCTTCGTGATACAAC
rJMSF027F05+ GAACTTTGATGATAATGCTGCTTACCGTCAGAAAGAAATCTTTTCCCTTCGTGATACAAC
rJMFF035E17+ GAACTTTGATGATAATGCTGCTTACCGTCAGAAAGAAATCTTTTCCCTTCGTGATACAAC
rJMFF039I22+ GAACTTTGATGATAATGCTGCTTACCGTCAGAAAGAAATCTTTTCCCTTCGTGATACAAC
rJMSF040F04+ GAACTTTGATGATAATGCTGCTTACCGTCAGAAAGAAATCTTTTCCCTTCGTGATACAAC
                      ____________________________________________________________
consensus GAACTTTGATGATAATGCTGCTTACCGTCAGAAAGAAATCTTTTCCCTTCGTGATACAAC
 
. : . : . : . : . : . :
rJMFF034F21+ ACAGGAGGACCCTCGTGAGGTTGCTGCTGCAAAAGCTGACTTGAATTACATTGGCTTAGA
rJMSF027F05+ ACAGGAGGACCCTCGTGAGGTTGCTGCTGCAAAAGCTGACTTGAATTACATTGGCTTAGA
rJMFF035E17+ ACAGGAGGACCCTCGTGAGGTTGCTGCTGCAAAAGCTGACTTGAATTACATTGGCTTAGA
rJMFF039I22+ ACAGGAGGACCCTCGTGAGGTTGCTGCTGCAAAAGCTGACTTGAATTACATTGGCTTAGA
rJMSF040F04+ ACAGGAGGACCCTCGTGAGGTTGCTGCTGCAAAAGCTGACTTGAATTACATTGGCTTAGA
                      ____________________________________________________________
consensus ACAGGAGGACCCTCGTGAGGTTGCTGCTGCAAAAGCTGACTTGAATTACATTGGCTTAGA
 
. : . : . : . : . : . :
rJMFF034F21+ TGGAGAAATTGGTTGCATGGTAAATGGTGCTGGATTGGCAATGGCTACCATGGACATAAT
rJMSF027F05+ TGGAGAAATTGGTTGCATGGTAAATGGTGCTGGATTGGCAATGGCTACCATGGACATAAT
rJMFF035E17+ TGGAGAAATTGGTTGCATGGTAAATGGTGCTGGATTGGCAATGGCTACCATGGACATAAT
rJMFF039I22+ TGGAGAAATTGGTTGCATGGTAAATGGTGCTGGATTGGCAATGGCTACCATGGACATAAT
rJMSF040F04+ TGGAGAAATTGGTTGCATGGTAAATGGTGCTGGATTGGCAATGGCTACCATGGACATAAT
                      ____________________________________________________________
consensus TGGAGAAATTGGTTGCATGGTAAATGGTGCTGGATTGGCAATGGCTACCATGGACATAAT
 
. : . : . : . : . : . :
rJMFF034F21+ TAAACTACATGGCGGAACTCCAGCCAATTTTCTTGATGTTGGTGGGAATGCTAGTGAAGG
rJMSF027F05+ TAAACTACATGGCGGAACTCCAGCCAATTTTCTTGATGTTGGTGGGAATGCTAGTGAAGG
rJMFF035E17+ TAAACTACATGGCGGAACTCCAGCCAATTTTCTTGATGTTGGTGGGAATGCTAGTGAAGG
rJMFF039I22+ TAAACTACATGGCGGAACTCCAGCCAATTTTCTTGATGTTGGTGGGAATGCTAGTGAAGG
rJMSF040F04+ TAAACTACATGGCGGAACTCCAGCCAATTTTCTTGATGTTGGTGGGAATGCTAGTGAAGG
                      ____________________________________________________________
consensus TAAACTACATGGCGGAACTCCAGCCAATTTTCTTGATGTTGGTGGGAATGCTAGTGAAGG
 
. : . : . : . : . : . :
rJMFF034F21+ CCAGGTCGTGGAAGCTTTTAAAATATTAACCTCAGATGACAAGGTGAAGGCAATTTTGGT
rJMSF027F05+ CCAGGTCGTGGAAGCTTTTAAAATATTAACCTCAGATGACAAGGTGAAGGCAATTTTGGT
rJMFF035E17+ CCAGGTCGTGGAAGCTTTTAAAATATTAACCTCAGATGACAAGGTGAAGGCAATTTTGGT
rJMFF039I22+ CCAGGTCGT-GAAGCTTTTAAAATATTAACCTCAGATGACAAGGTGAAGGCAATTTTGGT
rJMSF040F04+ CCAGGTCGTGGAAGCTTTTAAAATATTAACCTCAGATGACAAGGTGAAGGCAATTTTGGT
                      ____________________________________________________________
consensus CCAGGTCGTGGAAGCTTTTAAAATATTAACCTCAGATGACAAGGTGAAGGCAATTTTGGT
 
. : . : . : . : . : . :
rJMFF034F21+ GAACATTTTTGGAGGGATTATGAAATGCGATGTAATCGCCAGTGGAATTGTGAATGCTGC
rJMSF027F05+ GAACATTTTTGGAGGGATTATGAAATGCGATGTAATCGCCAGTGGAATTGTGAATGCTGC
rJMFF035E17+ GAACATTTTTGGAGGGATTATGAAATGCGATGTAATCGCCAGTGGAATTGTGAATGCTGC
rJMFF039I22+ GAACATTTTTGGAGGGATTATGAAATGCGATGTAATCGCCAGTGGAATTGTGAATGCTGC
rJMSF040F04+ GAACATTTTTGGAGGGATTATGAAATGCGATGTAATCGCCAGTGGAATTGTGAATGCTGC
                      ____________________________________________________________
consensus GAACATTTTTGGAGGGATTATGAAATGCGATGTAATCGCCAGTGGAATTGTGAATGCTGC
 
. : . : . : . : . : . :
rJMFF034F21+ AAAACAGGTTCAACTGAAAGTACCCGTCGTGGTTCGTCTCGAAGGAACCAACGTTGACCA
rJMSF027F05+ AAAACAGGTTCAACTGAAAGTACCCGTCGTGGTTCGTCTCGAAGGAACCAACGTTGACCA
rJMFF035E17+ AAAACAGGTTCAACTGAAAGTACCCGTCGTGGTTCGTCTCGAAGGAACCAACGTTGACCA
rJMFF039I22+ AAAACAGGTTCAACTGAAAGTACCCGTCGTGGTTCGTCTCGAAGGAACCAACGTTGACCA
rJMSF040F04+ AAAACAGGTTCAACTGAAAGTACCCGTCGTGGTTCGTCTCGAAGGAACCAACGTTGACCA
                      ____________________________________________________________
consensus AAAACAGGTTCAACTGAAAGTACCCGTCGTGGTTCGTCTCGAAGGAACCAACGTTGACCA
 
. : . : . : . : . : . :
rJMFF034F21+ AGGCAAGAGAATTCTCAAGGAAAGTGGTATGACACTTATTACCGCTGAAGATCTGGATGA
rJMSF027F05+ AGGCAAGAGAATTCTCAAGGAAAGTGGTATGACACTTATTACCGCTGAAGATCTGGATGA
rJMFF035E17+ AGGCAAGAGAATTCTCAAGGAAAGTGGTATGACACTTATTACCGCTGAAGATCTGGATGA
rJMFF039I22+ AGGCAAGAGAATTCTCAAGGAAAGTGGTATGACACTTATTACCGCTGAAGATCTGGATGA
rJMSF040F04+ AGGCAAGAGAATTCTCAAGGAAAGTGGTATGACACTTATTACCGCTGAAGATCTGGATGA
                      ____________________________________________________________
consensus AGGCAAGAGAATTCTCAAGGAAAGTGGTATGACACTTATTACCGCTGAAGATCTGGATGA
 
. : . : . : . : . : . :
rJMFF034F21+ TGCTGCTGAGAAAGCAGTTAAAGCAATTAGTGCTTAAATATTATTAGTTTTCATTGACTT
rJMSF027F05+ TGCTGCTGAGAAAGCAGTTAAAGCAATTAGTGCTTAAATATTATTAGTTTTCATTGACTT
rJMFF035E17+ TGCTGCTGAGAAAGCAGTTAAAGCAATTAGTGCTTAAATATTATTAGTTTTCATTGACTT
rJMFF039I22+ TGCTGCTGAGAAAGCAGTTAAAGCAATTAGTGCTTAAATATTATTAGTTTTCATTGACTT
rJMSF040F04+ TGCTGCTGAGAAAGCAGTTAAAGCAATTAGTGCTTAAATATTATTAGTTTTCATTGACTT
                      ____________________________________________________________
consensus TGCTGCTGAGAAAGCAGTTAAAGCAATTAGTGCTTAAATATTATTAGTTTTCATTGACTT
 
. : . : . : . : . : . :
rJMFF034F21+ TGGATATGTGATTAAATGTCTAAATGCACACACTCTCACACCACAATAGGAAAGTGGTGA
rJMSF027F05+ TGGATATGTGATTAAATGTCTAAATGCACACACTCTCACACCACAATAGGAAAGTGGTGA
rJMFF035E17+ TGGATATGTGATTAAATGTCTAAATGCACACACTCTCACACCACAATAGGAAAGTGGTGA
rJMFF039I22+ TGGATATGTGATTAAATGTCTAAATGCACACACTCTCACACCACAATAGGAAAGTGGTGA
rJMSF040F04+ TGGATATGTGATTAAATGTCTAAATGCACACACTCTCACACCACAATAGGAAAGTGGTGA
                      ____________________________________________________________
consensus TGGATATGTGATTAAATGTCTAAATGCACACACTCTCACACCACAATAGGAAAGTGGTGA
 
. : . : . : . : . : . :
rJMFF034F21+ TTTGCTTGCTTTTTTTCCATAAAATTTTTCAATAAGCCTCATTTTTGTTCTACAGAGGAT
rJMSF027F05+ TTTGCTTGCTTTTTTTCCATAAAATTTTTCAATAAGCCTCATTTTTGTTCTACAGAGGAT
rJMFF035E17+ TTTGCTTGCTTTTTTTCCATAAAATTTTTCAATAAGCCTCATTTTTGTTCTACAGAGGAT
rJMFF039I22+ TTTGCTTGCTTTTTTTCCATAAAATTTTTCAATAAGCCTCATTTTTGTTCTACAGAGGAT
rJMSF040F04+ TTTGCTTGCTTTTTTTCCATAAAATTTTTCAATAAGCCTCATTTTTGTTCTACAGAGGAT
                      ____________________________________________________________
consensus TTTGCTTGCTTTTTTTCCATAAAATTTTTCAATAAGCCTCATTTTTGTTCTACAGAGGAT
 
. : . : . : . : . : . :
rJMFF034F21+ ATCAATTGGATGGGCAGTCCC
rJMSF027F05+ ATCAATTGGATGGGCAGTCCCATAGTGT
rJMFF035E17+ ATCAATTGGATGGGCAGTCCCATAGTGTTGGATGTACATTTTTCTTTTTGTTCTGCTAAG
rJMFF039I22+ ATCAATTGGATGGGCAGTCCCATAGTGTTGGATGTACATTTTTCTTTTTGTTCTGCTAAG
rJMSF040F04+ ATCAATTGGATGGGCAGTCCCATAGTGTTGGATGTACATTTTTCTTTTTGTTCTGCTAAG
                      ____________________________________________________________
consensus ATCAATTGGATGGGCAGTCCCATAGTGTTGGATGTACATTTTTCTTTTTGTTCTGCTAAG
 
. : . : . : . : . : . :
rJMFF035E17+ GAAT
rJMFF039I22+ GAAT
rJMSF040F04+ GAATACTATTTCATTTAGTTTTAATTGTTTTTTTTTGTATCAATTGGATGGGCAGTCCCA
                      ____________________________________________________________
consensus GAATACTATTTCATTTAGTTTTAATTGTTTTTTTTTGTATCAATTGGATGGGCAGTCCCA