Previous Contig 013277:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF021N20Sequence673006025 (4)727013277 (4)gb:AC097277_17365092e-44Oryza sativa chromosome 3 BAC OSJNBa0022C08 genomic sequence, complete sequence.
JMSF040F02Sequence843013277 (4)gb:AP003240_18260304e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMSF040G02Sequence652006025 (4)852013277 (4)gb:AP003240_18260305e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P040
JMSF050H04Sequence682006025 (4)743013277 (4)gb:AC097277_17365097e-45Oryza sativa chromosome 3 BAC OSJNBa0022C08 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040G02+ GTGGTTGTGAACAG
rJMSF040F02+ ACAG
                      ____________________________________________________________
consensus GTGGTTGTGAACAG
 
. : . : . : . : . : . :
rJMSF040G02+ TCCGAGAGATATTGTTTTGGAAGCTCATCCGGGAGTTGAATCCACACGTTTTTATACA-G
rJMSF040F02+ TCCGAGAGATATTG-TTTGGAAGCTCATCCGGGAGTTGAATCCACACGTTTTTATACAGG
                      ____________________________________________________________
consensus TCCGAGAGATATTGTTTTGGAAGCTCATCCGGGAGTTGAATCCACACGTTTTTATACAGG
 
. : . : . : . : . : . :
rJMSF040G02+ GGGATTGTCAACGGTGCTTATAATTCCCCCTTCTTTATCACGCGGTTTCGAGAGGCTTTA
rJMSF050H04+ TCACGCGGTTTCGAGAGGCTTTA
rJMSF021N20+ TCACGCGGTTTCGAGAGGCTTTA
rJMSF040F02+ GGGATTGTCAACGGTGCTTATAATTCCCCCTTCTTTATCACGCGGTTTCGAGAGGCTTTA
                      ____________________________________________________________
consensus GGGATTGTCAACGGTGCTTATAATTCCCCCTTCTTTATCACGCGGTTTCGAGAGGCTTTA
 
. : . : . : . : . : . :
rJMSF040G02+ TTTCATTTCTCGTCTTTGTTTGACATGCTCGACACTAATGTTCCCCGCAATATCCACGAG
rJMSF050H04+ TTTCATTTCTCGTCNTTGTTTGACATGCTCGACACTAATGTTCCCCGCAATATCCACGAG
rJMSF021N20+ TTTCATTTCTCGTCTTTGTTTGACATGCTCGACACTAATGTTCCCCGCAATATCCACGAG
rJMSF040F02+ TTTCATTTCTCGTCTTTGTTTGACATGCTCGACACTAATGTTCCCCGCAATATCCACGAG
                      ____________________________________________________________
consensus TTTCATTTCTCGTCTTTGTTTGACATGCTCGACACTAATGTTCCCCGCAATATCCACGAG
 
. : . : . : . : . : . :
rJMSF040G02+ AGGATACTGATTGAGAAGACGATATTTGGGCAGGAAGCAAAGAACGTTATTGCGTGTGAA
rJMSF050H04+ AGGATACTGATTGAGAAGACGATATTTGGGCAGGAAGCAAAGAACGTTATTGCGTGTGAA
rJMSF021N20+ AGGATACTGATTGAGAAGACGATATTTGGGCAGGAAGCAAAGAACGTTATTGCGTGTGAA
rJMSF040F02+ AGGATACTGATTGAGAAGACGATATTTGGGCAGGAAGCAAAGAACGTTATTGCGTGTGAA
                      ____________________________________________________________
consensus AGGATACTGATTGAGAAGACGATATTTGGGCAGGAAGCAAAGAACGTTATTGCGTGTGAA
 
. : . : . : . : . : . :
rJMSF040G02+ ACCGCGGAGAGGGTCGAGAGGCCCGAGACATACAAGCAATGGCACGTTAGGAACATGCGG
rJMSF050H04+ ACCGCGGAGAGGGTCGAGAGGCCCGAGACATACAAGCAATGGCACGTTAGGAACATGCGG
rJMSF021N20+ ACCGCGGAGAGGGTCGAGAGGCCCGAGACATACAAGCAATGGCACGTTAGGAACATGCGG
rJMSF040F02+ ACCGCGGAGAGGGTCGAGAGGCCCGAGACATACAAGCAATGGCACGTTAGGAACATGCGG
                      ____________________________________________________________
consensus ACCGCGGAGAGGGTCGAGAGGCCCGAGACATACAAGCAATGGCACGTTAGGAACATGCGG
 
. : . : . : . : . : . :
rJMSF040G02+ GCGGGATTTCTTCCACTTCCTTTGAACAAGGAGATCATGAAGATGTCCAGAGACCGGGCC
rJMSF050H04+ GCGGGATTTCTTCCACTTCCTTTGAACAAGGAGATCATGAAGATGTCCAGAGACCGGGCC
rJMSF021N20+ GCGGGATTTCTTCCACTTCCTTTGAACAAGGAGATCATGAAGATGTCCAGAGACCGGGCC
rJMSF040F02+ GCGGGATTTCTTCCACTTCCTTTGAACAAGGAGATCATGAAGATGTCCAGAGACCGGGCC
                      ____________________________________________________________
consensus GCGGGATTTCTTCCACTTCCTTTGAACAAGGAGATCATGAAGATGTCCAGAGACCGGGCC
 
. : . : . : . : . : . :
rJMSF040G02+ AAGGTATACAACAAGGATTTTGTAATTGATGAAGACGGGGAATGGCTTCTTCAAGGATGG
rJMSF050H04+ AAGGTATACAACAAGGATTTTGTAATTGATGAAGACGGGGAATGGCTTCTTCAAGGATGG
rJMSF021N20+ AAGGTATACAACAAGGATTTTGTAATTGATGAAGACGGGGAATGGCTTCTTCAAGGATGG
rJMSF040F02+ AAGGTATACAACAAGGATTTTGTAATTGATGAAGACGGGGAATGGCTTCTTCAAGGATGG
                      ____________________________________________________________
consensus AAGGTATACAACAAGGATTTTGTAATTGATGAAGACGGGGAATGGCTTCTTCAAGGATGG
 
. : . : . : . : . : . :
rJMSF040G02+ AAGGGACGCATTGTCTATGCACTTTCCTCCTGGAGATCCGCTTCTTGATTTTGCTTAAGA
rJMSF050H04+ AAGGGACGCATTGTCTATGCACTTTCCTCCTGGAGATCCGCTTCTTGATTTTGCTTAAGA
rJMSF021N20+ AAGGGACGCATTGTCTATGCACTTTCCTCCTGGAGATCCGCTTCTTGATTTTGCTTAAGA
rJMSF040F02+ AAGGGACGCATTGTCTATGCACTTTCCTCCTGGAGATCCGCTTCTTGATTTTGCTTAAGA
                      ____________________________________________________________
consensus AAGGGACGCATTGTCTATGCACTTTCCTCCTGGAGATCCGCTTCTTGATTTTGCTTAAGA
 
. : . : . : . : . : . :
rJMSF040G02+ TCGTCGTTCTATCTATCAACAAGAAGCATGCAAGCTCGACTAAGCTCATCTCTTCTTTTG
rJMSF050H04+ TCGTCGTTCTATCTATCAACAAGAAGCATGCAAGCTCGACTAAGCTCATCTCTTCTTTTG
rJMSF021N20+ TCGTCGTTCTATCTATCAACAAGAAGCATGCAAGCTCGACTAAGCTCATCTCTTCTTTTG
rJMSF040F02+ TCGTCGTTCTATCTATCAACAAGAAGCATGCAAGCTCGACTAAGCTCATCTCTTCTTTTG
                      ____________________________________________________________
consensus TCGTCGTTCTATCTATCAACAAGAAGCATGCAAGCTCGACTAAGCTCATCTCTTCTTTTG
 
. : . : . : . : . : . :
rJMSF040G02+ CAAGCTGAGGTGGCTAAGTGGATGCATAGATTGGTCATTTGGAAGTGCATCAACGACAAA
rJMSF050H04+ CAAGCTGAGGTGGCTAAGTGGATGCATAGATTGGTCATTTGGAAGTGCATCAACGACAAA
rJMSF021N20+ CAAGCTGAGGTGGCTAAGTGGATGCATAGATTGGTCATTTGGAAGTGCATCAACGACAAA
rJMSF040F02+ CAAGCTGAGGTGGCTAAGTGGATGCATAGATTGGTCATTTGGAAGTGCATCAACGACAAA
                      ____________________________________________________________
consensus CAAGCTGAGGTGGCTAAGTGGATGCATAGATTGGTCATTTGGAAGTGCATCAACGACAAA
 
. : . : . : . : . : . :
rJMSF040G02+ GACAACCAACCATCCACCCAAATATACGCACACCAGAAACAGAACCTAAACAGTCGCAAG
rJMSF050H04+ GACAACCAACCATCCACCCAAATATACGCACACCAGAAACAGAACCTAAACAGTCGCAAG
rJMSF021N20+ GACAACCAACCATCCACCCAAATATACGCACACCAGAAACAGAACCTAAACAGTCGCAAG
rJMSF040F02+ GACAACCAACCATCCACCCAAATATACGCACACCAGAAACAGAACCTAAACAGTCGCAAG
                      ____________________________________________________________
consensus GACAACCAACCATCCACCCAAATATACGCACACCAGAAACAGAACCTAAACAGTCGCAAG
 
. : . : . : . : . : . :
rJMSF040G02+ TATAGGAATTTGCATTGCATGTTTACATCTGTAAATACTTGCGACTTTTGCCAATGATAT
rJMSF050H04+ TATAGGAATTTGCATTGCATGTTTACATCTGTAAATACTTGCGACTTTTGCCAATGATAT
rJMSF021N20+ TATAGGAATTTGCATTGCATGTTTACATCTGTAAATACTTGCGACTTTTGCCAATGATAT
rJMSF040F02+ TATAGGAATTTGCATTGCATGTTTACATCTGTAAATACTTGCGACTTTTGCCAATGATAT
                      ____________________________________________________________
consensus TATAGGAATTTGCATTGCATGTTTACATCTGTAAATACTTGCGACTTTTGCCAATGATAT
 
. : . : . : . : . : . :
rJMSF040G02+ TTTAGTTGTATGTAAATATGAACCTTTTGTCAAGAGCATATATATCCAGAATCAGATCAA
rJMSF050H04+ TTTAGTTGTATGTAAATATGAACCTTTTGTCAAGAGCATATATATCCAGAATCAGATCAA
rJMSF021N20+ TTTAGTTGTATGTAAATATGAACCTTTTGTCAAGAGCATATATATCCAGAATCAGATCAA
rJMSF040F02+ TTTAGTTGTATGTAAATATGAACCTTTTGTCAAGAGCATATATATCCAGAATCAGATCAA
                      ____________________________________________________________
consensus TTTAGTTGTATGTAAATATGAACCTTTTGTCAAGAGCATATATATCCAGAATCAGATCAA
 
. : . : . : . : . : . :
rJMSF040G02+ AGCTCTGAATGGGTTATATCTGGCCTTTAGGTATTGAATCTTGGTTGTTATAAAAAGTA
rJMSF050H04+ AGCTCTGAATGGGTTATATCTGGCCTTTAGGTATTGAATCTTGGTTGTTATAAAAAGTA
rJMSF021N20+ AGCTCTGAATGGGTTATATCTGGCCTTTAGGTATTGAATCT
rJMSF040F02+ AGCTCTGAATGGGTTATATCTGGCCTTTAGGTATTGAATCTTGGTTGTTATAAAAAGTAC
                      ____________________________________________________________
consensus AGCTCTGAATGGGTTATATCTGGCCTTTAGGTATTGAATCTTGGTTGTTATAAAAAGTAC