Previous Contig 013276:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF030K10Sequence648006684 (6)gb:AY500156_16096488e-18Lycopersicon esculentum MAP3Ka mRNA, complete cds.756013276 (2)gb:AY500156_16096483e-22Lycopersicon esculentum MAP3Ka mRNA, complete cds.
JMSF040E20Sequence680006684 (6)gb:AY500156_16096482e-22Lycopersicon esculentum MAP3Ka mRNA, complete cds.862013276 (2)gb:AY500155_16096473e-31Nicotiana benthamiana MAP3Ka mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040E20+ CCAGTGAAGCAAAAAGTTTTATAA
                      ____________________________________________________________
consensus CCAGTGAAGCAAAAAGTTTTATAA
 
. : . : . : . : . : . :
rJMSF040E20+ GGNTATGCTTGCAGCGAGAGCCATCAGCACGACCCACAGCATCACAACTTCTGGATCACC
                      ____________________________________________________________
consensus GGNTATGCTTGCAGCGAGAGCCATCAGCACGACCCACAGCATCACAACTTCTGGATCACC
 
. : . : . : . : . : . :
rJMSF030K10+ ACATCAAAAGTTG-CCCATCGTAATGTAATCAATGAAGTA
rJMSF040E20+ CTTTCATTAAAGACCAAAACACATCAAAAGTTGCCCCATCGTAATGTAATCAATGAAGTA
                      ____________________________________________________________
consensus CTTTCATTAAAGACCAAAACACATCAAAAGTTGCCCCATCGTAATGTAATCAATGAAGTA
 
. : . : . : . : . : . :
rJMSF030K10+ CAACCTCGGAGCTTTGATGGGAGCTGTACACCGCCGGCGGCCCTGGAGCTGCTGCATCCT
rJMSF040E20+ CAACCTCGGAGCTTTGATGGGAGCTGTACACCGCCGGCGGCCCTGGAGCTGCTGCATCCT
                      ____________________________________________________________
consensus CAACCTCGGAGCTTTGATGGGAGCTGTACACCGCCGGCGGCCCTGGAGCTGCTGCATCCT
 
. : . : . : . : . : . :
rJMSF030K10+ AGCCAAAGAAATTTTGCTTCTCTTGATGGAGACTACGCAGTGAACCACATGGTAAATGTG
rJMSF040E20+ AGCCAAAGAAATTTTGCTTCTCTTGATGGAGACTACGCAGTGAACCACATGGTAAATGTG
                      ____________________________________________________________
consensus AGCCAAAGAAATTTTGCTTCTCTTGATGGAGACTACGCAGTGAACCACATGGTAAATGTG
 
. : . : . : . : . : . :
rJMSF030K10+ TTTAGACCCATGATTAGTTCAAGAGACAATGCAAAAACCATTACGTCTTCATTGCCTGTA
rJMSF040E20+ TTTAGACCCATGATTAGTTCAAGAGACAATGCAAAAACCATTACGTCTTCATTGCCTGTA
                      ____________________________________________________________
consensus TTTAGACCCATGATTAGTTCAAGAGACAATGCAAAAACCATTACGTCTTCATTGCCTGTA
 
. : . : . : . : . : . :
rJMSF030K10+ TCACCATGTTCAAGTCCTCTAAGACGACATAGTGAAGAAGCACGCAGGAGCTGTTATCTT
rJMSF040E20+ TCACCATGTTCAAGTCCTCTAAGACGACATAGTGAAGAAGCACGCAGGAGCTGTTATCTT
                      ____________________________________________________________
consensus TCACCATGTTCAAGTCCTCTAAGACGACATAGTGAAGAAGCACGCAGGAGCTGTTATCTT
 
. : . : . : . : . : . :
rJMSF030K10+ TCTCCTCCAAACCCATCATCTTATCATCCTTTCGCCACCACCCAATTTGGAAACAACCAT
rJMSF040E20+ TCTCCTCCAAACCCATCATCTTATCATCCTTTCGCCACCACCCAATTTGGAAACAACCAT
                      ____________________________________________________________
consensus TCTCCTCCAAACCCATCATCTTATCATCCTTTCGCCACCACCCAATTTGGAAACAACCAT
 
. : . : . : . : . : . :
rJMSF030K10+ CCCGACTACTCCTCAACCTTTGCAGCAAGAGTCAACACAAGGAACACACTGGATCCATGG
rJMSF040E20+ CCCGACTACTCCTCAACCTTTGCAGCAAGAGTCAACACAAGGA--ACACTGGATCCATGG
                      ____________________________________________________________
consensus CCCGACTACTCCTCAACCTTTGCAGCAAGAGTCAACACAAGGAACACACTGGATCCATGG
 
. : . : . : . : . : . :
rJMSF030K10+ CTTGATATTCCTCAATATAGAACACAAACACCTGGTAGATCTTCAACAAGAACAATGCCC
rJMSF040E20+ CTTGATATTCCTCAATATAGAACACAAACACCTGGTAGATCTTCAACAAGAACAATGCCC
                      ____________________________________________________________
consensus CTTGATATTCCTCAATATAGAACACAAACACCTGGTAGATCTTCAACAAGAACAATGCCC
 
. : . : . : . : . : . :
rJMSF030K10+ ATTCTCTAGTTAGGAAAACTTTCCATCCTCTGATCCAACCAAGATTGCCACTACAGTTTG
rJMSF040E20+ ATTCTCTAGTTAGGAAAACTTTCCATCCTCTGATCCAACCAAGATTGCCACTACAGTTTG
                      ____________________________________________________________
consensus ATTCTCTAGTTAGGAAAACTTTCCATCCTCTGATCCAACCAAGATTGCCACTACAGTTTG
 
. : . : . : . : . : . :
rJMSF030K10+ AAGCGCAACGAATCAACTGCAATGTTGCATTCGATTCAGGGTACTTCTAACTAACTACTG
rJMSF040E20+ AAGCGCAACGAATCAACTGCAATGTTGCATTCGATTCAGGGTACTTCTAACTAACTACTG
                      ____________________________________________________________
consensus AAGCGCAACGAATCAACTGCAATGTTGCATTCGATTCAGGGTACTTCTAACTAACTACTG
 
. : . : . : . : . : . :
rJMSF030K10+ CTGTGTTTTCCCCTCTTGTTTGTTGGTGAGTGGGCAATTTTGGATGATCAGATCAGTCTT
rJMSF040E20+ CTGTGTTTTCCCCTCTTGTTTGTTGGTGAGTGGGCAATTTTGGATGATCAGATCAGTCTT
                      ____________________________________________________________
consensus CTGTGTTTTCCCCTCTTGTTTGTTGGTGAGTGGGCAATTTTGGATGATCAGATCAGTCTT
 
. : . : . : . : . : . :
rJMSF030K10+ CTTCAGTTGCAGCAATTCACCATCCCACTGGCTACTATCTTGGGTATATATTATATAATA
rJMSF040E20+ CTTCAGTTGCAGCAATTCACCATCCCACTGGCTACTATCTTGGGTATATATTATATAATA
                      ____________________________________________________________
consensus CTTCAGTTGCAGCAATTCACCATCCCACTGGCTACTATCTTGGGTATATATTATATAATA
 
. : . : . : . : . : . :
rJMSF030K10+ ATTGTATTGTGTATGTAAATTATACTTTTTCTTCTCTGAAATGTAAATGAAAGATGA
rJMSF040E20+ ATTGTATTGTGTATGTAAATTATACTTTTTCTTCTCTGAAATGTAAATGAAAGATGACAC
                      ____________________________________________________________
consensus ATTGTATTGTGTATGTAAATTATACTTTTTCTTCTCTGAAATGTAAATGAAAGATGACAC