Previous Contig 013274:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015B01Sequence510007345 (2)gb:AY086168_15712235e-17Arabidopsis thaliana clone 21943 mRNA, complete sequence.630013274 (2)gb:AY086168_15712235e-35Arabidopsis thaliana clone 21943 mRNA, complete sequence.
JMSF040D15Sequence668007345 (2)gb:AY086168_15712232e-24Arabidopsis thaliana clone 21943 mRNA, complete sequence.405013274 (2)gb:AY086168_15712234e-06Arabidopsis thaliana clone 21943 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF015B01+ CCAAAGATGCATNTTTGGGAAACTGGGATCATGNGAATTN
                      ____________________________________________________________
consensus CCAAAGATGCATNTTTGGGAAACTGGGATCATGNGAATTN
 
. : . : . : . : . : . :
rJMSF015B01+ CTNGGCACCCCCNGATGGTNGGGCNGGTGANGTGGTGCCNTGCTCACCCTNTATGGNTTG
                      ____________________________________________________________
consensus CTNGGCACCCCCNGATGGTNGGGCNGGTGANGTGGTGCCNTGCTCACCCTNTATGGNTTG
 
. : . : . : . : . : . :
rJMSF015B01+ GGAACTNGGNTGCTGTGGNGGCNTCCNTGGGTTTGATAGGNCCCCNTTTGTTTGGAGCCN
                      ____________________________________________________________
consensus GGAACTNGGNTGCTGTGGNGGCNTCCNTGGGTTTGATAGGNCCCCNTTTGTTTGGAGCCN
 
. : . : . : . : . : . :
rJMSF015B01+ GGAANGGGGNCCGGNGGNTGGGAATNCGATATGGGGNGGCTTTTGAAGCTGTGAAGAATA
                      ____________________________________________________________
consensus GGAANGGGGNCCGGNGGNTGGGAATNCGATATGGGGNGGCTTTTGAAGCTGTGAAGAATA
 
. : . : . : . : . : . :
rJMSF015B01+ GAACNAGCNTCNTTCCNTTTGCNGCAATTGTAGATGGTNNCCCGAAGTTGCCNAAAGNTT
rJMSF040D15+ ATTGTAGATGGTNNCCNGAAGTTGCCNAAAGNTT
                      ____________________________________________________________
consensus GAACNAGCNTCNTTCCNTTTGCNGCAATTGTAGATGGTNNCCCGAAGTTGCCNAAAGNTT
 
. : . : . : . : . : . :
rJMSF015B01+ NTTNCAAAGAATTTGTTAGNTTGCCNTACTTGTCCNTAACNGTATTGNCCTTAGGNGCCT
rJMSF040D15+ NTTNCAAAGAATTTGTTAGNTTGCCNTACTTGTCCNTAACNGTNTTGNCCTTNGGNGCCT
                      ____________________________________________________________
consensus NTTNCAAAGAATTTGTTAGNTTGCCNTACTTGTCCNTAACNGTATTGNCCTTAGGNGCCT
 
. : . : . : . : . : . :
rJMSF015B01+ ACTTTGCCCNCCCNCTCNTGCNGGNTGCNGGNTTCNGGNTTCNCTGGTAGTTCAACNTNT
rJMSF040D15+ NCTTTGCCCNCCCCCTCNTGCNGGNTGCNGGGTTCNGGNTTCNCTGGTAGTTCAACNTNT
                      ____________________________________________________________
consensus ACTTTGCCCNCCCCCTCNTGCNGGNTGCNGGGTTCNGGNTTCNCTGGTAGTTCAACNTNT
 
. : . : . : . : . : . :
rJMSF015B01+ CNCTTTTGNTCCNTGTAAAAATAAAAATAANGTAATNTTTTTCNCCCNTGGGGNGTAGAT
rJMSF040D15+ CNCTTTTGNTCCNNGTAAAAATAAAAATAANGTAATNTTTTTCNCCCNTGGGGNGTAGAT
                      ____________________________________________________________
consensus CNCTTTTGNTCCNTGTAAAAATAAAAATAANGTAATNTTTTTCNCCCNTGGGGNGTAGAT
 
. : . : . : . : . : . :
rJMSF015B01+ GAGGCGGTGCGGGTGCGGGGTGCCGGTNTNTTCAAGTTTAACCNAAGGNATATAGGGTTT
rJMSF040D15+ GAGGCGGNGCGGGTGCGGGGTGCCGGTNTTTTCAAGNTTAACCNAAGGNATATAGGGNTT
                      ____________________________________________________________
consensus GAGGCGGTGCGGGTGCGGGGTGCCGGTNTTTTCAAGTTTAACCNAAGGNATATAGGGTTT
 
. : . : . : . : . : . :
rJMSF015B01+ AGCNTATCCNGNCTAAGGAAACTTGTGGTCCGNCAAAAAAAAAAAGTGAAATACTTCCCA
rJMSF040D15+ AGCNTATCCNGNCTAAGGNAACTTGNGGTCCGNCAAAAAAAAAAAGTGAAATACTTCCCA
                      ____________________________________________________________
consensus AGCNTATCCNGNCTAAGGAAACTTGTGGTCCGNCAAAAAAAAAAAGTGAAATACTTCCCA
 
. : . : . : . : . : . :
rJMSF015B01+ TTGCATTTATGCCCGGCTTTAAGAAGCTGGTCTAACCATATTTCATACAG
rJMSF040D15+ TTGCATTTATGCCCGGCTTTAAGAAGCTGGTCTAACCATATTTCATACAGTATAAATAAT
                      ____________________________________________________________
consensus TTGCATTTATGCCCGGCTTTAAGAAGCTGGTCTAACCATATTTCATACAGTATAAATAAT