Previous Contig 013271:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002L14Sequence386008062 (6)712013271 (5)gb:AY063937_15658849e-61Arabidopsis thaliana putative protein phosphatase 2A regulatory subunit B (At5g2
JMSF026J18Sequence695008062 (6)gb:AF411955_17972855e-14Musa acuminata protein phosphatase 2AB regulatory subunit-like protein (PPA2AB) 706013271 (5)gb:AE016959_10230865e-27Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07
JMSF040C08Sequence679008062 (6)gb:AF411955_17972851e-13Musa acuminata protein phosphatase 2AB regulatory subunit-like protein (PPA2AB) 784013271 (5)gb:AE016959_10230864e-36Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07
JMSF051I18Sequence678008062 (6)gb:AB005239_15094403e-09Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MLN1.>gb:AY099553_15765702013271 (5)gb:AE016959_10230862e-32Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07
JMSF051M11Sequence688008062 (6)gb:AF411955_17972851e-11Musa acuminata protein phosphatase 2AB regulatory subunit-like protein (PPA2AB) 731013271 (5)gb:AE016959_10230867e-35Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC07

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF002L14+ CAGGAATGAAATGCAGTTC
                      ____________________________________________________________
consensus CAGGAATGAAATGCAGTTC
 
. : . : . : . : . : . :
rJMSF002L14+ TTTTATGAGGAGCAGCTGCATAGAATGGAATGCATGGCCCAAGAGCCAGTGCTTTTTGAG
                      ____________________________________________________________
consensus TTTTATGAGGAGCAGCTGCATAGAATGGAATGCATGGCCCAAGAGCCAGTGCTTTTTGAG
 
. : . : . : . : . : . :
rJMSF002L14+ GATATTTTGTGCCAGATTGTCGACATGATTAGTCCGGAGGAAGAAAGCTATGTTACATTA
rJMSF040C08+ TTA
                      ____________________________________________________________
consensus GATATTTTGTGCCAGATTGTCGACATGATTAGTCCGGAGGAAGAAAGCTATGTTACATTA
 
. : . : . : . : . : . :
rJMSF002L14+ CGTGACTTGAAGGGCAGCAAACTATCAGGCAGTGTTTTCAACATACTTTTTAACCNCAAT
rJMSF051M11+ TGAAGGGCAGCCAACTATCAGGCAGTGTTTTCAACATACTTTTTAACCTCAAT
rJMSF051I18+ TTCAACATACTTTTTAACCTCAAT
rJMSF026J18+ TTTCAACATACTTTTTAACCTCAAT
rJMSF040C08+ CGTGACNTGAAGGGCAGCAAACTATCAGGCAGTGTTTTCAACATACTTTTTAACCTCAAT
                      ____________________________________________________________
consensus CGTGACTTGAAGGGCAGCAAACTATCAGGCAGTGTTTTCAACATACTTTTTAACCTCAAT
 
. : . : . : . : . : . :
rJMSF002L14+ AAATTTATGGCATTTGAAACTCGTGATCCTTTCCTAATTCGTCAGGAGCGCGAGAATCCA
rJMSF051M11+ AAATTTATGGCATTTGAAACTCGTGATCCNTTCCTAATTCGTCAGGAGCGCGAGAATCCA
rJMSF051I18+ AAATTTATGGCATTTGAAACTCGTGATCCTTTCCTAATTCGTCAGGAGCGCGAGAATCCA
rJMSF026J18+ AAATTTATGGCA-TTGAAACTCGTGATCCTTTCCTAATTCGTCAGGAGCGCGAGAATCCA
rJMSF040C08+ AAATTTATGGCATTTGAAACTCGTGATCCTTTCCTAATTCGTCAGGAGCGCGAGAATCCA
                      ____________________________________________________________
consensus AAATTTATGGCATTTGAAACTCGTGATCCTTTCCTAATTCGTCAGGAGCGCGAGAATCCA
 
. : . : . : . : . : . :
rJMSF002L14+ AATTTGACCGAGTGGGATCGCTTTGCACATAGAGAATATATTAGGCTTTCAATGGAGGAA
rJMSF051M11+ AATTTGACCGAGTGGGATCGCTTTGCACATAGAGAATATATTAGGCTTTCAATGGAGGAA
rJMSF051I18+ AATTTGACCGAGTGGGATCGCTTTGCACATAGAGAATATATTAGGCTTTCAATGGAGGAA
rJMSF026J18+ AATTTGACCGAGTGGGATCGCTTTGCACATAGAGAATATATTAGGCTTTCAATGGAGGAA
rJMSF040C08+ AATTTGACCGAGTGGGATCGCTTTGCACATAGAGAATATATTAGGCTTTCAATGGAGGAA
                      ____________________________________________________________
consensus AATTTGACCGAGTGGGATCGCTTTGCACATAGAGAATATATTAGGCTTTCAATGGAGGAA
 
. : . : . : . : . : . :
rJMSF002L14+ GATGCTGAAGATGCCTCCAATGGAAGTGCTGATGTGTGGGATGAATCNCTCGAGGCTCCC
rJMSF051M11+ GATGCTGAAGATGCCTCCAATGGAAGTGCTGATGTGTGGGATGAATCACTCGAGGCTCCC
rJMSF051I18+ GATGCTGAAGATGCCTCCAATGGAAGTGCTGATGTGTGGGATGAATCNCTCGAGGCTCCC
rJMSF026J18+ GATGCTGAAGATGCCTCCAATGGAAGTGCTGATGTGTGGGATGAATCACTCGAGGCTCCC
rJMSF040C08+ GATGCTGAAGATGCCTCCAANGGAAGTGCTGATGTGTGGGATGAATCACTCGAGGCTCCC
                      ____________________________________________________________
consensus GATGCTGAAGATGCCTCCAATGGAAGTGCTGATGTGTGGGATGAATCACTCGAGGCTCCC
 
. : . : . : . : . : . :
rJMSF002L14+ TTTTGAGTATTAGTTGTGAGTTATGCAAAATATATGAAAGGTGATTGTAGGGAATTTTAT
rJMSF051M11+ TTTTGAGTATTAGTTGTGAGTTATGCAAAATATATGAAAGGTGATTGTAGGGAATTTTAT
rJMSF051I18+ TTTTGAGTATTAGTTGTGAGTTATGCAAAATATATGAAAGGTGATTGTAGGGAATTTTAT
rJMSF026J18+ TTTTGAGTATTAGTTGTGAGTTATGCAAAATATATGAAAGGTGATTGTAGGGAATTTTAT
rJMSF040C08+ TTTTGAGTATTAGTTGTGAGCTATGCAAAATATATGAAAGGTGATTGTAGGGAATTTTAT
                      ____________________________________________________________
consensus TTTTGAGTATTAGTTGTGAGTTATGCAAAATATATGAAAGGTGATTGTAGGGAATTTTAT
 
. : . : . : . : . : . :
rJMSF002L14+ TTGGCCTGGCTTTTGGACAGTGAAGGACAATTTTGCACAGCAAACTCGTGGGATTAGCGG
rJMSF051M11+ TTGGCCNGGCTTTTGGACAGTGAAGGACAATTTTGCACAGCAAACTCGTGGGATTAGCGG
rJMSF051I18+ TTGGCCTGGCTTTTGGACAGTGAAGGACAATTTTGCACAGCAAACTCGTGGGATTAGCGG
rJMSF026J18+ TTGGCCTGGCTTTTGGACAGTGAAGGACAATTTTGCNCAGCAAACTCGTGGGATTAGCGG
rJMSF040C08+ TTGGCCTGGCTTTTGGACAGTGAAGGACAATTTTGCACAGCAAACTCGTGGGATTAGCGG
                      ____________________________________________________________
consensus TTGGCCTGGCTTTTGGACAGTGAAGGACAATTTTGCACAGCAAACTCGTGGGATTAGCGG
 
. : . : . : . : . : . :
rJMSF002L14+ ATGTGTCTTATTCCNCCAAAGGTGTTTTTTTTTTATTGCTAGAGGGATTTCGATTGTATC
rJMSF051M11+ ATGTGTCTTATTCCNCCAAAGGNGTTTTTTTTTTATTGCTAGAGGGATTTCGATTGTATC
rJMSF051I18+ ATGTGTCTTATTCCNCCAAAGGTGTTTTTTTTTTATTGCTAGAGGGATTTCGATTGTATC
rJMSF026J18+ ATGTGTCTTATTCCNCCAAAGGTGTTTTTTTTTTATTGCTAGAGGGATTTCGATTGTATC
rJMSF040C08+ ATGTGTCTTATTCCNCCAAAGGTGTTTTTTTTTTATTGCTAGAGGGATTTCGATTGTATC
                      ____________________________________________________________
consensus ATGTGTCTTATTCCNCCAAAGGTGTTTTTTTTTTATTGCTAGAGGGATTTCGATTGTATC
 
. : . : . : . : . : . :
rJMSF002L14+ TGCACAAAGCTTGGTTTCCAAGTCGAATACCCATTCTAGTGTACAAGCTTCTTCTGACTT
rJMSF051M11+ TGCACAAAGCTTGGTTTCCAAGTCGAATACCCATTCTAGTGTACAAGCTTCTTCTGACTT
rJMSF051I18+ TGCACAAAGCTTGGTTTCCAAGTCGAATACCCATTCTAGTGTACAAGCTTCTTCTGACTT
rJMSF026J18+ TGCACAAAGCTTGGTTTCCAAGTCGAATACCCATTCTAGTGTACAAGCTTCTTCTGACTT
rJMSF040C08+ TGCACAAAGCTTGGTTTCCAAGTCGAATACCCATTCTAGTGTACAAGCTTCTTCTGACTT
                      ____________________________________________________________
consensus TGCACAAAGCTTGGTTTCCAAGTCGAATACCCATTCTAGTGTACAAGCTTCTTCTGACTT
 
. : . : . : . : . : . :
rJMSF002L14+ CGATGTCCAAGTGTTTTGGCAACTCCACCAATTGGCAATTGGCGATTTTGCTGAAACTGG
rJMSF051M11+ CGATGTCCAAGTGTTTTGGCAACTCCACCAATTGGCAATTGGCGATTTTGCTGAAACTGG
rJMSF051I18+ CGATGTCCAAGTGTTTTGGCAACTCCACCAATTGGCAATTGGCGATTTTGCTGAAACTGG
rJMSF026J18+ CGATGTCCAAGTGTTTTGGCAACTCCACCAATTGGCAATTGGCGATTTTGCTGAAACTGG
rJMSF040C08+ CGATGTCCAAGTGTTTTGGCAACTCCACCAATTGGCAATTGGCGATTTTGCTGAAACTGG
                      ____________________________________________________________
consensus CGATGTCCAAGTGTTTTGGCAACTCCACCAATTGGCAATTGGCGATTTTGCTGAAACTGG
 
. : . : . : . : . : . :
rJMSF002L14+ TTCTGATAATTCACAACTTCTAGCACTTCTTTC
rJMSF051M11+ TTCTGATAATTCACAACTTCTAGCACTTCTTTCTGTAGTTGTAAGGAACTGTGATTATTA
rJMSF051I18+ TTCTGATAATTCACAACTTCTAGCACTTCTTTCTGTAGTTGTAAGGAACTGTGATTATTA
rJMSF026J18+ TTCTGATAATTCACAACTTCTAGCACTTCTTTCTGTAGTTGTAAGGAACTGTGATTATTA
rJMSF040C08+ TTCTGATAATTCACAACTTCTAGCACTTCTTTCTGTAGTTGTAAGGAACTGTGATTATTA
                      ____________________________________________________________
consensus TTCTGATAATTCACAACTTCTAGCACTTCTTTCTGTAGTTGTAAGGAACTGTGATTATTA
 
. : . : . : . : . : . :
rJMSF051M11+ ATTATTTGTTTCTAGAGAAAATGTTAGTGTTGTTTTTTCTATATACGCTTTTTCTCCGAG
rJMSF051I18+ ATTATTTGTTTCTAGAGAAAATGTTAGTGTTGTTTTTTCTATATACGCTTTTTCTCCGAG
rJMSF026J18+ ATTATTTGTTTCTAGAGAAAATGTTAGTGTTGTTTTTTCTATATACGCTTTTTCTCCGAG
rJMSF040C08+ ATTATTTGTTTCTAGAGAAAATGTTAGTGTTGTTTTTTCTATATACGCTTTTTCTCCGAG
                      ____________________________________________________________
consensus ATTATTTGTTTCTAGAGAAAATGTTAGTGTTGTTTTTTCTATATACGCTTTTTCTCCGAG
 
. : . : . : . : . : . :
rJMSF051M11+ GGGGGTTCAGGTTCAGCATGGTGACTGGTGAGTGCCATGATGTAGTGTCGTCTTCTTTTC
rJMSF051I18+ GGGGGTTCAGGTTCAGCATGGTGACTGGTGAGTGCCATGATGTAGTGTCGTCTTCTTTTC
rJMSF026J18+ GGGGGTTCAGGTTCAGCATGGTGACTGGTGAGTGCCATGATGTAGTGNCGTCTTCTTTTC
rJMSF040C08+ GGGGGTTCAGGTTCAGCATGGTGACTGGTGAGTGCCATGATGTAGTGTCGTCTTCTTTTC
                      ____________________________________________________________
consensus GGGGGTTCAGGTTCAGCATGGTGACTGGTGAGTGCCATGATGTAGTGTCGTCTTCTTTTC
 
. : . : . : . : . : . :
rJMSF051M11+ CCCCCTTTCCCAATTCGT
rJMSF051I18+ CCCCCTTTCCCAATTCGT
rJMSF026J18+ CCCCCTTTCCCAATTCGT
rJMSF040C08+ CCCCCTTTCCCAATTCGTTGTCTTCAACATTTGTGATGGACCTTTGTAATGATATCTTTT
                      ____________________________________________________________
consensus CCCCCTTTCCCAATTCGTTGTCTTCAACATTTGTGATGGACCTTTGTAATGATATCTTTT