Previous Contig 013269:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045O12Sequence611002056 (2)gb:ATAC012395_15434792e-05Arabidopsis thaliana chromosome III BAC T1B9 genomic sequence, complete sequence622013269 (2)gb:AF492825_18049916e-22Phaseolus vulgaris zinc finger-like protein (ZFL) mRNA, partial cds.
JMSF040B20Sequence625020049gb:ATAC012395_15434792e-05Arabidopsis thaliana chromosome III BAC T1B9 genomic sequence, complete sequence840013269 (2)gb:AF492825_18049918e-19Phaseolus vulgaris zinc finger-like protein (ZFL) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040B20+ CGTGCCGATGAACAACCGGAGTATGAGCCGGAGGCATTCGAATCGGGTCGCGGATGCGGA
                      ____________________________________________________________
consensus CGTGCCGATGAACAACCGGAGTATGAGCCGGAGGCATTCGAATCGGGTCGCGGATGCGGA
 
. : . : . : . : . : . :
rJMSF040B20+ GTATCCGGGGGCGAATATAAGCCGGAGCTAACGGCATCGTCGTCGAGAAGAGAGCTTAGG
                      ____________________________________________________________
consensus GTATCCGGGGGCGAATATAAGCCGGAGCTAACGGCATCGTCGTCGAGAAGAGAGCTTAGG
 
. : . : . : . : . : . :
rJMSF040B20+ TCAACTCCGTCGAATCGAATGTCGTTGACGAGGAACGAAAGCCGGACGGGAAATCGGAGC
                      ____________________________________________________________
consensus TCAACTCCGTCGAATCGAATGTCGTTGACGAGGAACGAAAGCCGGACGGGAAATCGGAGC
 
. : . : . : . : . : . :
rJMSF040B20+ TTGAAGTTGCAGGGCTCGATGTCGATCAGAAGAGGCGGAGAAGCGGAGAGCGAAGGAGGC
                      ____________________________________________________________
consensus TTGAAGTTGCAGGGCTCGATGTCGATCAGAAGAGGCGGAGAAGCGGAGAGCGAAGGAGGC
 
. : . : . : . : . : . :
rJMSF040B20+ GAGGAGGGAGAAGGAGATGAACCGATGAGGATGTCGTTAATGGCGCTTTTGGGAGATCAA
                      ____________________________________________________________
consensus GAGGAGGGAGAAGGAGATGAACCGATGAGGATGTCGTTAATGGCGCTTTTGGGAGATCAA
 
. : . : . : . : . : . :
rJMFF045O12+ TGATGGATGAAGAGGAGGAAGAAGAAGACGGTTGCGAAGATTACGGCGGAGAATTCCAT
rJMSF040B20+ TTGATGGAGGAGGAGGAGGAAGACGGAGGCAGTTGCGAGGATTACGGAGGAGAATTCCGT
                      ____________________________________________________________
consensus TTGATGGATGAGGAGGAGGAAGACGGAGGCGGTTGCGAGGATTACGGCGGAGAATTCCGT
 
. : . : . : . : . : . :
rJMFF045O12+ AACTGCTGTGTCTGTATGGTTAGACACAAAGGAGAGGCGTTCGTGCCATGCGGACACACC
rJMSF040B20+ AACTGCTGCGTGTGTATGGTTAGACACAAGGGGGAAGCATTCGATCCATGTGGACACACA
                      ____________________________________________________________
consensus AACTGCTGTGTGTGTATGGTTAGACACAAGGGGGAGGCGTTCGTTCCATGTGGACACACC
 
. : . : . : . : . : . :
rJMFF045O12+ TTTTGCAGGCTCTGCTCAAGGGAGCTCTGGGCTGAGAAGGGCAA---TTGTCCACTCTGC
rJMSF040B20+ TTTTGCAGGCTCTGCTCAAGGGAGCTCTGGGCTGAGAAGGGGAAAACTTGTCCACTCTGC
                      ____________________________________________________________
consensus TTTTGCAGGCTCTGCTCAAGGGAGCTCTGGGCTGAGAAGGGGAAAACTTGTCCACTCTGC
 
. : . : . : . : . : . :
rJMFF045O12+ AGCAATTTGATCCTCGAAATTCTCGACATTTTCTGA
rJMSF040B20+ AACAAGTTCATCCTCGAAATTCTCGACATCTTCTGATCCCAAAAAACATGTTGATACTCG
                      ____________________________________________________________
consensus AGCAATTTGATCCTCGAAATTCTCGACATTTTCTGATCCCAAAAAACATGTTGATACTCG
 
. : . : . : . : . : . :
rJMSF040B20+ AGCAATTTGAAGTTACCACTACTGGAAGGTCAGTTTGGGATCTTCAAACAATTTCTAGCA
                      ____________________________________________________________
consensus AGCAATTTGAAGTTACCACTACTGGAAGGTCAGTTTGGGATCTTCAAACAATTTCTAGCA
 
. : . : . : . : . : . :
rJMSF040B20+ GTTCTGTCCTAAGTGTGTATTTCATCCTAGGGTTGGTTCAGATGATTCCAGAAGAATCCA
                      ____________________________________________________________
consensus GTTCTGTCCTAAGTGTGTATTTCATCCTAGGGTTGGTTCAGATGATTCCAGAAGAATCCA
 
. : . : . : . : . : . :
rJMSF040B20+ AGAGGGAAGATGGAATTGTCTACTACGGATAATTCATGTTATTGCATATAATAATTACGT
                      ____________________________________________________________
consensus AGAGGGAAGATGGAATTGTCTACTACGGATAATTCATGTTATTGCATATAATAATTACGT
 
. : . : . : . : . : . :
rJMSF040B20+ CAATGGATTATTATTAGTGATATATAGGTAATATAATTGGTATGTTGCATAATACTCATC
                      ____________________________________________________________
consensus CAATGGATTATTATTAGTGATATATAGGTAATATAATTGGTATGTTGCATAATACTCATC
 
. : . : . : . : . : . :
rJMSF040B20+ CATTATATTGTCTCAAATTTGAGAATATTCATTTGCTCAAATTTGTTTTGTAGCAATGTC
                      ____________________________________________________________
consensus CATTATATTGTCTCAAATTTGAGAATATTCATTTGCTCAAATTTGTTTTGTAGCAATGTC