Previous Contig 013267:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011N11Sequence239007399 (8)768013267 (3)gb:AP005067_18475011e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048
JMSF040B08Sequence667007399 (8)778013267 (3)gb:AP005067_18475011e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048
JMSF041D20Sequence756007399 (8)645013267 (3)gb:AP005067_18475018e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P048

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF011N11+ AATGTGGTGGTGCTATCGGTGGTATTGGAGGAGGTGAAGAACAAGAACA
rJMSF040B08+ GCGATTGATAATGTGGTGGTGCTATCGGTGGTATTGGAGGAGNTGAAGAACAAGAACA
                      ____________________________________________________________
consensus GCGATTGATAATGTGGTGGTGCTATCGGTGGTATTGGAGGAGGTGAAGAACAAGAACA
 
. : . : . : . : . : . :
rJMSF011N11+ TTTCTGTTTATAATAGACTTAGAGCCCTATGTAGCAATTCTCTCAGGAAGTTCTTTGTCT
rJMSF040B08+ TTTCTGTTTATAATAGACTTAGAGCCCTATGTAGCAATTCTCTCAGGAAGTTCTTTGTCT
                      ____________________________________________________________
consensus TTTCTGTTTATAATAGACTTAGAGCCCTATGTAGCAATTCTCTCAGGAAGTTCTTTGTCT
 
. : . : . : . : . : . :
rJMSF041D20+ CCAATGAGTACCATAAGGATACATATGTGAAGGCCATGCCTGGTGAAAGTCCAAATG
rJMSF011N11+ TTTCCAATGAGTACCATAAGGATACATATGTGAAGGCCATGCCTGGTGAAAGTCCAAATG
rJMSF040B08+ TTTCCAATGAGTACCATAAGGATACATATGTGAAGGCCATGCCTGGTGAAAGTCCAAATG
                      ____________________________________________________________
consensus TTTCCAATGAGTACCATAAGGATACATATGTGAAGGCCATGCCTGGTGAAAGTCCAAATG
 
. : . : . : . : . : . :
rJMSF041D20+ ATCGTAATGACAGGGAATTCCATAAATGGAGTCTAAAGCTGCTGTCAAATACCAACCTTT
rJMSF011N11+ ATCGTAATGACAGGGAATTCCATAAATGGAGTCTAAAGCTGCTGTCAAATACCAACCTTT
rJMSF040B08+ ATCGTAATGACAGGGAATTCCATAAATGGAGTCTAAAGCTGCTGTCAAATACCAACCTTT
                      ____________________________________________________________
consensus ATCGTAATGACAGGGAATTCCATAAATGGAGTCTAAAGCTGCTGTCAAATACCAACCTTT
 
. : . : . : . : . : . :
rJMSF041D20+ GAGAGGGGGGAGAAATAGATGGGCACTTGAAGATATTGGAAATCTTGTGATTGCTCCTGT
rJMSF011N11+ GAGAGGGGGGAGAAATAGATGGGCACTTGAAGATATTGGAAATCTTGTGATTGCTCCTGT
rJMSF040B08+ GAGAGGGGGGAGAAATAGATGGGCACTTGAAGATATTGGAAATCTTGTGATTGCTCCTGT
                      ____________________________________________________________
consensus GAGAGGGGGGAGAAATAGATGGGCACTTGAAGATATTGGAAATCTTGTGATTGCTCCTGT
 
. : . : . : . : . : . :
rJMSF041D20+ TGTTGATAGTAAACCGCAGACCCGCCCCATCACAAGAAGCTTTACTGCACAATGTCTATG
rJMSF011N11+ TGTTGATAGTAAACCGCAGACCCGCCCCATCACAAGAAGCTTTACTGCACAATGTCTATG
rJMSF040B08+ TGTTGATAGTAAACCGCAGACCCGCCCCATCACAAGAAGCTTTACTGCACAATGTCTATG
                      ____________________________________________________________
consensus TGTTGATAGTAAACCGCAGACCCGCCCCATCACAAGAAGCTTTACTGCACAATGTCTATG
 
. : . : . : . : . : . :
rJMSF041D20+ AAGAGGTTCTGGAGATTGTTTCTTATATGACATTTTACTCGCCAAAAATATCAATGAACA
rJMSF011N11+ AAGAGGTTCTGGAGATTGTTTCTTATATGACATTTTACTCGCCAAAAATATCAATGAACA
rJMSF040B08+ AAGAGGTTCTGGAGATTGTTTCTTATATGACATTTTACTCGCCAAAAATATCAATGAACA
                      ____________________________________________________________
consensus AAGAGGTTCTGGAGATTGTTTCTTATATGACATTTTACTCGCCAAAAATATCAATGAACA
 
. : . : . : . : . : . :
rJMSF041D20+ TGTGGAGTCTCTGGCCATTAATGATGGAGGCCCTTGCAGACTGGGCTATTGATTATTTCC
rJMSF011N11+ TGTGGAGTCTCTGGCCATTAATGATGGAGGCCCTTGCAGACTGGGCTATTGATTATTTCC
rJMSF040B08+ TGTGGAGTCTCTGGCCATTAATGATGGAGGCCCTTGCAGACTGGGCTATTGATTATTTCC
                      ____________________________________________________________
consensus TGTGGAGTCTCTGGCCATTAATGATGGAGGCCCTTGCAGACTGGGCTATTGATTATTTCC
 
. : . : . : . : . : . :
rJMSF041D20+ CAAACATATTGGTTCCATTGGACAACTATATATCGAGGAGCACTGAACATTTCCTTACTT
rJMSF011N11+ CAAACATATTGGTTCCATTGGACAACTATATATCGAGGAGCACTGAACATTTCCTTACTT
rJMSF040B08+ CAAACATATTGGTTCCATTGGACAACTATATATCGAGGAGCACTGAACATTTCCTTACTT
                      ____________________________________________________________
consensus CAAACATATTGGTTCCATTGGACAACTATATATCGAGGAGCACTGAACATTTCCTTACTT
 
. : . : . : . : . : . :
rJMSF041D20+ GCAAGGAGAAGGTCATGACATCAATGGAGAAACCCTCGTATACAATGCGTGTTCCAAGGA
rJMSF011N11+ GCAAGGAGAAGGTCATGACATCAATGGAGAAACCCTCGTATACAATGCGTGTTCCAAGGA
rJMSF040B08+ GCAAGGAGAAGGTCATGACATCAATGGAGAAACCCTCGTATACAATGCGTGTTCCAAGGA
                      ____________________________________________________________
consensus GCAAGGAGAAGGTCATGACATCAATGGAGAAACCCTCGTATACAATGCGTGTTCCAAGGA
 
. : . : . : . : . : . :
rJMSF041D20+ AGTCAGAACCGGATTACTATTTGGGCCAAGTACTGCCAGTACTCCAGCGAAGACGTGTAT
rJMSF011N11+ AGTCAGAACCGGATTACTATTTGGGCCAAGTACTGCCAGTACTCCAGCGAAGACGTGTAT
rJMSF040B08+ AGTCAGAACCGGATTACTATTTGGGCCAAGTACTGCCAGTACTCCAGCGAAGACGTGTAT
                      ____________________________________________________________
consensus AGTCAGAACCGGATTACTATTTGGGCCAAGTACTGCCAGTACTCCAGCGAAGACGTGTAT
 
. : . : . : . : . : . :
rJMSF041D20+ GTAGGCGAGCTTGTTTCTGCTATTAGTTCTTTTCCAATGCTCAAGAAAATATATTTTTTG
rJMSF011N11+ GTAGGCGAGCTTGTTTCTGCTATTAGTTCTTTTCCAATGCTCAAGAAAATATATTTTTTG
rJMSF040B08+ GTAGGCGAGCTTGTTTCTGCTATTAGTTCTTTTCCAATGCTCAAGAAAATATATTTTTTG
                      ____________________________________________________________
consensus GTAGGCGAGCTTGTTTCTGCTATTAGTTCTTTTCCAATGCTCAAGAAAATATATTTTTTG
 
. : . : . : . : . : . :
rJMSF041D20+ GCAAGTTTACCTCTTGTAGACAAAATTCATATGTTTTGATGATATTAT
rJMSF011N11+ GCAAGTTTACCTCTTGTAGACAAAATTCATATGTTTTGATGATATTATTGTATTAAAGT
rJMSF040B08+ GCAAGTTTACCTCTTGTAGACAAAATTCATATGTTTTGATGATATTATTGTATTAAAGTA
                      ____________________________________________________________
consensus GCAAGTTTACCTCTTGTAGACAAAATTCATATGTTTTGATGATATTATTGTATTAAAGTA