Previous Contig 013260:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF039P13Sequence678013260 (2)735013260 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039P13- GGCAACCAAACAACC
rJMSF039P13+ GGCAACCAAACAACC
                      ____________________________________________________________
consensus GGCAACCAAACAACC
 
. : . : . : . : . : . :
JMSF039P13- CCCATCCGCCCCTTTTCTCTTGTCTCTCTCTCTCCCGTTCGAAGCCAGCAGATCAGCAAC
rJMSF039P13+ CCCATCCGCCCCTTTTCTCTTGTCTCTCTCTCTCCCGTTCGAAGCCAGCAGATCAGCAAC
                      ____________________________________________________________
consensus CCCATCCGCCCCTTTTCTCTTGTCTCTCTCTCTCCCGTTCGAAGCCAGCAGATCAGCAAC
 
. : . : . : . : . : . :
JMSF039P13- AACAACACAGTAAACCGGCAGCCTTGAACCTTCACCTCTGCCTCCTTCTCTTGCTCGGCG
rJMSF039P13+ AACAACACAGTAAACCGGCAGCCTTGAACCTTCACCTCTGCCTCCTTCTCTTGCTCGGCG
                      ____________________________________________________________
consensus AACAACACAGTAAACCGGCAGCCTTGAACCTTCACCTCTGCCTCCTTCTCTTGCTCGGCG
 
. : . : . : . : . : . :
JMSF039P13- GTGGCCTGAAGCTGGCCAGAGACTATGGCGGCAAGCGAGATCCCAGTCTCTTCTGTCTCT
rJMSF039P13+ GTGGCCTGAAGCTGGCCAGAGACTATGGCGGCAAGCGAGATCCCAGTCTCTTCTGTCTCT
                      ____________________________________________________________
consensus GTGGCCTGAAGCTGGCCAGAGACTATGGCGGCAAGCGAGATCCCAGTCTCTTCTGTCTCT
 
. : . : . : . : . : . :
JMSF039P13- CGTCTCCCTCTCTCTCGGCAGCAGCAATGGTGACCAGCAGAACTGAACGGCGGCGAGGTG
rJMSF039P13+ CGTCTCCCTCTCTCTCGGCAGCAGCAATGGTGACCAGCAGAACTGAACGGCGGCGAGGTG
                      ____________________________________________________________
consensus CGTCTCCCTCTCTCTCGGCAGCAGCAATGGTGACCAGCAGAACTGAACGGCGGCGAGGTG
 
. : . : . : . : . : . :
JMSF039P13- GAGCTCTGGCGAGCTACGGCAGTGACCGGCGCCTGGGAAGAAACGACGGTGGATGGTCCC
rJMSF039P13+ GAGCTCTGGCGAGCTACGGCAGTGACCGGCGCCTGGGAAGAAACGACGGTGGATGGTCCC
                      ____________________________________________________________
consensus GAGCTCTGGCGAGCTACGGCAGTGACCGGCGCCTGGGAAGAAACGACGGTGGATGGTCCC
 
. : . : . : . : . : . :
JMSF039P13- TCCGGCGTGGCAGCTTGGACAGTGGTGGTCAGTGACGTTCTCCTCCGGCAAGAGAAACAG
rJMSF039P13+ TCCGGCGTGGCAGCTTGGACAGTGGTGGTCAGTGACGTTCTCCTCCGGCAAGAGAAACAG
                      ____________________________________________________________
consensus TCCGGCGTGGCAGCTTGGACAGTGGTGGTCAGTGACGTTCTCCTCCGGCAAGAGAAACAG
 
. : . : . : . : . : . :
JMSF039P13- AAATCCGTAGGTTTCTCGTTAAAGTAGTTAGCTCGGGAGTGAGCTCAAGAATCGAATGCT
rJMSF039P13+ AAATCCGTAGGTTTCTCGTTAAAGTAGTTAGCTCGGGAGTGAGCTCAAGAATCGAATGCT
                      ____________________________________________________________
consensus AAATCCGTAGGTTTCTCGTTAAAGTAGTTAGCTCGGGAGTGAGCTCAAGAATCGAATGCT
 
. : . : . : . : . : . :
JMSF039P13- TGGCTTTGGAAGCTTAGCTTGAGGATTTGAAGTTGTTGCTAGTTCGAGAGTGCGGCGTAG
rJMSF039P13+ TGGCTTTGGAAGCTTAGCTTGAGGATTTGAAGTTGTTGCTAGTTCGAGAGTGCGGCGTAG
                      ____________________________________________________________
consensus TGGCTTTGGAAGCTTAGCTTGAGGATTTGAAGTTGTTGCTAGTTCGAGAGTGCGGCGTAG
 
. : . : . : . : . : . :
JMSF039P13- AGCTCGTAGTCTTGGATTTGAGTTTGGTATAACTGGTTTAGTCTTAGAACTTGAATTGTT
rJMSF039P13+ AGCTCGTAGTCTTGGATTTGAGTTTGGTATAACTGGTTTAGTCTTAGAACTTGAATTGTT
                      ____________________________________________________________
consensus AGCTCGTAGTCTTGGATTTGAGTTTGGTATAACTGGTTTAGTCTTAGAACTTGAATTGTT
 
. : . : . : . : . : . :
JMSF039P13- GTTGTAGTTAATTTGTGATTTGGAAAGTGAAATGTTGTAATATGGATTTGTAGATAGAAA
rJMSF039P13+ GTTGTAGTTAATTTGTGATTTGGAAAGTGAAATGTTGTAATATGGATTTGTAGATAGAAA
                      ____________________________________________________________
consensus GTTGTAGTTAATTTGTGATTTGGAAAGTGAAATGTTGTAATATGGATTTGTAGATAGAAA
 
. : . : . : . : . : . :
JMSF039P13- CCGTTTTAGCCGGTGCGTTTGGGCTTAGTTGGCTGCCCAAGCGTGGCATAGCACCCCAAT
rJMSF039P13+ CCGTTTTAGCCGGTGCGTTTGGGCTTAGTTGGCTGCCCAAGCGTGGCATAGCACCCCAAT
                      ____________________________________________________________
consensus CCGTTTTAGCCGGTGCGTTTGGGCTTAGTTGGCTGCCCAAGCGTGGCATAGCACCCCAAT
 
. : . : . : . : . : . :
JMSF039P13- GGT
rJMSF039P13+ GGTTTAGATTTTGATTTTTGCTTCCGCATTTGTATTTAGTCATTTAGTAAGAAAAGTCTT
                      ____________________________________________________________
consensus GGTTTAGATTTTGATTTTTGCTTCCGCATTTGTATTTAGTCATTTAGTAAGAAAAGTCTT