Previous Contig 013247:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002P20Sequence239007317 (5)735013247 (4)gb:AY065207_15663611e-58Arabidopsis thaliana unknown protein (At5g53450) mRNA, complete cds.
JMSF015B03Sequence250007317 (5)782013247 (4)gb:AY065207_15663617e-68Arabidopsis thaliana unknown protein (At5g53450) mRNA, complete cds.
JMSF039M22Sequence642007317 (5)gb:AB020754_15146994e-24Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYN8.>gb:BT002001_16356807013247 (4)gb:AB020754_15146998e-67Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYN8.>gb:BT002001_16356
JMSF045H14Sequence764007317 (5)gb:AB020754_15146991e-47Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYN8.>gb:BT002001_16356707013247 (4)gb:AY065207_15663612e-54Arabidopsis thaliana unknown protein (At5g53450) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF015B03+ GAGTCNTGGT
rJMSF039M22+ ATCGAGTTGATTAGATGGAGTCTTGGT
                      ____________________________________________________________
consensus ATCGAGTTGATTAGATGGAGTCTTGGT
 
. : . : . : . : . : . :
rJMSF015B03+ TCAACTGCTGTTCGGATCACAGAGGAATACA-TTTATGCTCACCAGCAGCGAAATAGGCT
rJMSF002P20+ GCTCACCAGCAGCGAAATAGGCT
rJMSF039M22+ TCAACTGCTGTTCGAATCACAGAGGAATACATTTTATGCTCACCAGCAGCGAAATAGGCT
                      ____________________________________________________________
consensus TCAACTGCTGTTCGGATCACAGAGGAATACATTTTATGCTCACCAGCAGCGAAATAGGCT
 
. : . : . : . : . : . :
rJMSF015B03+ CGCACATTTTATNGAACTCATGGAGATCTTAAATCCTCATTCTAAACCTAAGCATTGGCT
rJMSF002P20+ CGCACA-TTTATTGAACTCATGGAGATCTTAAATCCTCATTCTAAACCTAAGCATTGGCT
rJMSF045H14+ AGCATTGGCT
rJMSF039M22+ CGCACATTTTATTGAACTCATGGAGATCTTAAATCCTCATTCTAAACCTAAGCATTGGCT
                      ____________________________________________________________
consensus CGCACATTTTATTGAACTCATGGAGATCTTAAATCCTCATTCTAAACCTAAGCATTGGCT
 
. : . : . : . : . : . :
rJMSF015B03+ GGAAAAGCTTCCTGGGAAATGGCGTCTCTTATACTGCACAGGCAAACACATAGGGCTAAC
rJMSF002P20+ GGAAAAGCTTCCTGGGAAATGGCGTCTCTTATACTGCACAGGCAAACACATAGGGCTAAC
rJMSF045H14+ GGAAAAGCTTCCTGGGAAATGGCGTCTCTTATACTGCACAGGCAAACACATAGGGCTAAC
rJMSF039M22+ GGAAAAGCTTCCTGGGAAATGGCGTCTCTTATACTGCACAGGCAAACACATAGGGCTAAC
                      ____________________________________________________________
consensus GGAAAAGCTTCCTGGGAAATGGCGTCTCTTATACTGCACAGGCAAACACATAGGGCTAAC
 
. : . : . : . : . : . :
rJMSF015B03+ TCTCCGGCAGCCTTCATTTCGCGTGCTTATTGGTGACGGGCACCTTACCATATCCAAATC
rJMSF002P20+ TCTCCGGCAGCCTTCATTTCGCGTGCTTATTGGTGACGGGCACCTTACCATATCCAAATC
rJMSF045H14+ TCTCCGGCAGCCTTCATTTCGCGTGCTTATTGGTGACGGGCACCTTACCATATCCAAATC
rJMSF039M22+ TCTCCGGCAGCCTTCATTTCGCGTGCTTATTGGTGACGGGCACCTTACCATATCCAAATC
                      ____________________________________________________________
consensus TCTCCGGCAGCCTTCATTTCGCGTGCTTATTGGTGACGGGCACCTTACCATATCCAAATC
 
. : . : . : . : . : . :
rJMSF015B03+ ATCAAAACCCAAAACAACATTTTCAGTCTCCTCCCACATCGGTTTCAGAGTTGTGATTGG
rJMSF002P20+ ATCAAAACCCAAAACAACATTTTCAGTCTCCTCCCACATCGGTTTCAGAGTTGTGATTGG
rJMSF045H14+ ATCAAAACCCAAAACAACATTTTCAGTCTCCTCCCACATCGGTTTCAGAGTTGTGATTGG
rJMSF039M22+ ATCAAAACCCAAAACAACATTTTCAGTCTCCTCCCACATCGGTTTCAGAGTTGTGATTGG
                      ____________________________________________________________
consensus ATCAAAACCCAAAACAACATTTTCAGTCTCCTCCCACATCGGTTTCAGAGTTGTGATTGG
 
. : . : . : . : . : . :
rJMSF015B03+ AAAGGACTGGCCTCACGACAAGTCTGGCGTCAATGGGGCATTGCAAACAGGCACTTCTTT
rJMSF002P20+ AAAGGACTGGCCTCACGACAAGTCTGGCGTCAATGGGGCATTGCAAACAGGCACTTCTTT
rJMSF045H14+ AAAGGACTGGCCTCACGACAAGTCTGGCGTCAATGGGGCATTGCAAACAGGCACTTCTTT
rJMSF039M22+ AAAGGACTGGCCTCACGACAAGTCTGGCGTCAATGGGGCATTGCAAACAGGCACTTCTTT
                      ____________________________________________________________
consensus AAAGGACTGGCCTCACGACAAGTCTGGCGTCAATGGGGCATTGCAAACAGGCACTTCTTT
 
. : . : . : . : . : . :
rJMSF015B03+ CACACTGAGAGCCGGTAGGCGGCTGTATCTTACAGAGGAAACTACCACAACGAAGCTACC
rJMSF002P20+ CACACTGAGAGCCGGTAGGCGGCTGTATCTTACAGAGGAAACTACCACAACGAAGCTACC
rJMSF045H14+ CACACTGAGAGCCGGTAGGCGGCTGTATCTTACAGAGGAAACTACCACAACGAAGCTACC
rJMSF039M22+ CACACTGAGAGCCGGTAGGCGGCTGTATCTTACAGAGGAAACTACCACAACGAAGCTACC
                      ____________________________________________________________
consensus CACACTGAGAGCCGGTAGGCGGCTGTATCTTACAGAGGAAACTACCACAACGAAGCTACC
 
. : . : . : . : . : . :
rJMSF015B03+ CTCATCATCAACACAGGATTCTCAGGCTGCTTCTGTACAGAAACGGCTATCCAGTAACCA
rJMSF002P20+ CTCATCATCAACACAGGATTCTCAGGCTGCTTCTGTACAGAAACGGCTATCCAGTAACCA
rJMSF045H14+ CTCATCATCAACACAGGATTCTCAGGCTGCTTCTGTACAGAAACGGCTATCCAGTAACCA
rJMSF039M22+ CTCATCATCAACACAGGATTCTCAGGCTGCTTCTGTACAGAAACGGCTATCCAGTAACCA
                      ____________________________________________________________
consensus CTCATCATCAACACAGGATTCTCAGGCTGCTTCTGTACAGAAACGGCTATCCAGTAACCA
 
. : . : . : . : . : . :
rJMSF015B03+ GTGGAGAAAAGTCGTTCCTATAAAGGAATTCCCTTCGAGCCTCCCCGTAACCAAACTGAT
rJMSF002P20+ GTGGAGAAAAGTCGTTCCTATAAAGGAATTCCCTTCGAGCCTCCCCGTAACCAAACTGAT
rJMSF045H14+ GTGGAGAAAAGTCGTTCCTATAAAGGAATTCCCTTCGAGCCTCCCCGTAACCAAACTGAT
rJMSF039M22+ GTGGAGAAAAGTCGTTCCTATAAAGGAATTCCCTTCGAGCCTCCCCGTAACCAAACTGAT
                      ____________________________________________________________
consensus GTGGAGAAAAGTCGTTCCTATAAAGGAATTCCCTTCGAGCCTCCCCGTAACCAAACTGAT
 
. : . : . : . : . : . :
rJMSF015B03+ ATCAGGCGATATTGAGGTGACAATGTCTCTGGACGAGCCGCTAGTCCGGAATGTAGAAAT
rJMSF002P20+ ATCAGGCGATATTGAGGTGACAATGTCTCTGGACGAGCCGCTAGTCCGGAATGTAGAAAT
rJMSF045H14+ ATCAGGCGATATTGAGGTGACAATGTCTCTGGACGAGCCGCTAGTCCGGAATGTAGAAAT
rJMSF039M22+ ATCAGGCGATATTGAGGTGACAATGTCTCTGGACGAGCCGCTAGTCCGGAATGTAGAAAT
                      ____________________________________________________________
consensus ATCAGGCGATATTGAGGTGACAATGTCTCTGGACGAGCCGCTAGTCCGGAATGTAGAAAT
 
. : . : . : . : . : . :
rJMSF015B03+ GGCACAGAGGGTAGTTCAAGAAGTTAGAGTGCAAGTCCCTCCTGAAATGTTTGATCCTTC
rJMSF002P20+ GGCACAGAGGGTAGTTCAAGAAGTTAGAGTGCAAGTCCCTCCTGAAATGTTTGATCCTTC
rJMSF045H14+ GGCACAGAGGGTAGTTCAAGAAGTTAGAGTGCAAGTCCCTCCTGAAATGTTTGATCCTTC
rJMSF039M22+ GGCACAGAGGGTAGTTCAAGAAGTTAGAGTGCAAGTCCCTCCTGAAATGTTTGATCCTTC
                      ____________________________________________________________
consensus GGCACAGAGGGTAGTTCAAGAAGTTAGAGTGCAAGTCCCTCCTGAAATGTTTGATCCTTC
 
. : . : . : . : . : . :
rJMSF015B03+ ACAACTTGTCTGTGGAACGTACGTAGATTCAAGGTTGCTCGTTCTTCGTAGTGTCAATGG
rJMSF002P20+ ACAACTTGTCTGTGGAACGTACGTAGATTCAAGGTTGCTCGTTCTTCGTAGTGTCAATGG
rJMSF045H14+ ACAACTTGTCTGTGGAACGTACGTAGATTCAAGGTTGCTCGTTCTTCGTAGTGTCAATGG
rJMSF039M22+ ACAACTTGTCTGTGGAACGTACGTAGATTCAAGGTTGCTCGTTCTTCGTAGTGTCAATGG
                      ____________________________________________________________
consensus ACAACTTGTCTGTGGAACGTACGTAGATTCAAGGTTGCTCGTTCTTCGTAGTGTCAATGG
 
. : . : . : . : . : . :
rJMSF015B03+ TTCTGCTCTCCTTTTCACAAGATCTTGTACGCACGAAGAATTGTGAATATATT
rJMSF002P20+ TTCTGCTCTCCTTTTCACAAGATCTTGTACGCACGAAGAATTGTGAATATATT
rJMSF045H14+ TTCTGCTCTCCTTTTCACAAGATCTTGTACGCACGAAGAATTGTGAATATATT
rJMSF039M22+ TTCTGCTCTCCTTTTCACAAGATCTTGTACGCACGAAGAATTGTGAATATATTTGTTTTG
                      ____________________________________________________________
consensus TTCTGCTCTCCTTTTCACAAGATCTTGTACGCACGAAGAATTGTGAATATATTTGTTTTG