Previous Contig 013245:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF047P17Sequence643007315 (3)gb:AF465780_18021603e-61Lycopersicon esculentum lecithine cholesterol acyltransferase-like protein mRNA,608013245 (3)gb:AF465780_18021602e-56Lycopersicon esculentum lecithine cholesterol acyltransferase-like protein mRNA,
JMSF039M15Sequence639007315 (3)gb:AF465780_18021606e-57Lycopersicon esculentum lecithine cholesterol acyltransferase-like protein mRNA,856013245 (3)gb:AF465780_18021602e-78Lycopersicon esculentum lecithine cholesterol acyltransferase-like protein mRNA,
JMSF039P06Sequence642007315 (3)gb:AF465780_18021603e-63Lycopersicon esculentum lecithine cholesterol acyltransferase-like protein mRNA,821013245 (3)gb:AF465780_18021604e-79Lycopersicon esculentum lecithine cholesterol acyltransferase-like protein mRNA,

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039M15+ ATTTAATGGTGAAATC
                      ____________________________________________________________
consensus ATTTAATGGTGAAATC
 
. : . : . : . : . : . :
rJMSF039P06+ CCCGAAATATTTTAAACCGTGCAAAGAAGCCTCCTCAAGT
rJMSF039M15+ TTGAAATGGGCCAATGAGACCCCGAAATATTTTAANCCGTGCAAAGAAGCCTCCTCAAGT
                      ____________________________________________________________
consensus TTGAAATGGGCCAATGAGACCCCGAAATATTTTAAACCGTGCAAAGAAGCCTCCTCAAGT
 
. : . : . : . : . : . :
rJMSF039P06+ CAAATTTTATAATATCTATGGGACTAACTATGATACACCACATACTGTCAGTTATGGAAG
rJMSF039M15+ CAAATTTTATAATATCTATGGGACTAACTATGATACACCACATACTGTCAGTTATGGAAG
                      ____________________________________________________________
consensus CAAATTTTATAATATCTATGGGACTAACTATGATACACCACATACTGTCAGTTATGGAAG
 
. : . : . : . : . : . :
rJMSF039P06+ TGCAGATAAACCTGTCTCAGATTTAAAGCAGCTACCTTTTGTAACGGCTGATTTCATATA
rJMFF047P17+ TATA
rJMSF039M15+ TGCAGATAAACCTGTCTCAGATTTAAAGCAGCTACCTTTTGTAACGGCTGATTTCATATA
                      ____________________________________________________________
consensus TGCAGATAAACCTGTCTCAGATTTAAAGCAGCTACCTTTTGTAACGGCTGATTTCATATA
 
. : . : . : . : . : . :
rJMSF039P06+ TGTTGATGGTGATGGAACAGTTCCAACAGAATCTGCAAAGGCAGATGGGCTTAATGCAGA
rJMFF047P17+ TGTTGATGGTGATGGAACAGTTCCAACAGAATCTGCAAAGGCAGATGGGCTTAATGCAGA
rJMSF039M15+ TGTTGATGGTGATGGAACAGTTCCAACAGAATCTGCAAAGGCAGATGGGCTTAATGCAGA
                      ____________________________________________________________
consensus TGTTGATGGTGATGGAACAGTTCCAACAGAATCTGCAAAGGCAGATGGGCTTAATGCAGA
 
. : . : . : . : . : . :
rJMSF039P06+ AGCAAGGGTTGGAGTCCCTGCAGATCACAGAGGGATCATCTGTGATCGTTATGTTTTTAG
rJMFF047P17+ AGCAAGGGTTGGAGTCCCTGCAGATCACAGAGGGATCATCTGTGATCGTTATGTTTTTAG
rJMSF039M15+ AGCAAGGGTTGGAGTCCCTGCAGATCACAGAGGGATCATCTGTGATCGTTATGTTTTTAG
                      ____________________________________________________________
consensus AGCAAGGGTTGGAGTCCCTGCAGATCACAGAGGGATCATCTGTGATCGTTATGTTTTTAG
 
. : . : . : . : . : . :
rJMSF039P06+ GGTTATCAAACACTGGCTGAAGGCGGATCACGATCCTTTCTATAATCCCGTTAACGATTA
rJMFF047P17+ GGTTATCAAACACTGGCTGAAGGCGGATCACGATCCTTTCTATAATCCCGTTAACGATTA
rJMSF039M15+ GGTTATCAAACACTGGCTGAAGGCGGATCACGATCCTTTCTATAATCCCGTTAACGATTA
                      ____________________________________________________________
consensus GGTTATCAAACACTGGCTGAAGGCGGATCACGATCCTTTCTATAATCCCGTTAACGATTA
 
. : . : . : . : . : . :
rJMSF039P06+ TGTTATCCTTCCCACCTTGTTTGACATGGAGAGGCGCCAAGAAAAAGGGTTGGAGATCAC
rJMFF047P17+ TGTTATCCTTCCCACCTTGTTTGACATGGAGAGGCGCCAAGAAAAAGGGTTGGAGATCAC
rJMSF039M15+ TGTTATCCTTCCCACCTTGTTTGACATGGAGAGGCGCCAAGAAAAAGGGTTGGAGATCAC
                      ____________________________________________________________
consensus TGTTATCCTTCCCACCTTGTTTGACATGGAGAGGCGCCAAGAAAAAGGGTTGGAGATCAC
 
. : . : . : . : . : . :
rJMSF039P06+ TTCCCTCAAGGAGGAATGGGAAATTATATCAGAAGGGGCAGAGTATGTGGCGGATGAAAA
rJMFF047P17+ TTCCCTCAAGGAGGAATGGGAAATTATATCAGAAGGGGCAGAGTATGTGGCGGATGAAAA
rJMSF039M15+ TTCCCTCAAGGAGGAATGGGAAATTATATCAGAAGGGGCAGAGTATGTGGCGGATGAAAA
                      ____________________________________________________________
consensus TTCCCTCAAGGAGGAATGGGAAATTATATCAGAAGGGGCAGAGTATGTGGCGGATGAAAA
 
. : . : . : . : . : . :
rJMSF039P06+ GCCGATTGTGGGTTCTATTTGTGTTTCTCGTGTCGGGGAAGACAATGTTTCACGGGAAGA
rJMFF047P17+ GCCGATTGTGGGTTCTATTTGTGTTTCTCGTGTCGGGGAAGACAATGTTTCACGGGAAGA
rJMSF039M15+ GCCGATTGTGGGTTCTATTTGTGTTTCTCGTGTCGGGGAAGACAATGTTTCACGGGAAGA
                      ____________________________________________________________
consensus GCCGATTGTGGGTTCTATTTGTGTTTCTCGTGTCGGGGAAGACAATGTTTCACGGGAAGA
 
. : . : . : . : . : . :
rJMSF039P06+ TGCTCAAGCCACTGTGGTTGTTCACCCTGCGCTCGATGGTAAGAAATGCCATGTTGAACT
rJMFF047P17+ TGCTCAAGCCACTGTGGTTGTTCACCCTGCGCTCGATGGTAAGAAATGCCATGTTGAACT
rJMSF039M15+ TGCTCAAGCCACTGTGGTTGTTCACCCTGCGCTCGATGGTAAGAAATGCCATGTTGAACT
                      ____________________________________________________________
consensus TGCTCAAGCCACTGTGGTTGTTCACCCTGCGCTCGATGGTAAGAAATGCCATGTTGAACT
 
. : . : . : . : . : . :
rJMSF039P06+ TAGTGCCATGTCTGTCTCGACGAATGTATAAATTTTAGCTGCCGATTCATATTCATCGTG
rJMFF047P17+ TAGTGCCATGTCTGTCTCGACGAATGTATAAATTTTAGCTGCCGATTCATATTCATCGTG
rJMSF039M15+ TAGTGCCATGTCTGTCTCGACGAATGTATAAATTTTAGCTGCCGATTCATATTCATCGTG
                      ____________________________________________________________
consensus TAGTGCCATGTCTGTCTCGACGAATGTATAAATTTTAGCTGCCGATTCATATTCATCGTG
 
. : . : . : . : . : . :
rJMSF039P06+ GAAGTGGTATTGATGTGTGTTGGGCTGACTTTATTTATATATATATATATTTCTGTATAT
rJMFF047P17+ GAAGTGGTATTGATGTGTGTTGGGCTGACTTTATTTATATATATATATATTTCTGTATAT
rJMSF039M15+ GAAGTGGTATTGATGTGTGTTGGGCTGACTTTATTTATATATATATATATTTCTGTATAT
                      ____________________________________________________________
consensus GAAGTGGTATTGATGTGTGTTGGGCTGACTTTATTTATATATATATATATTTCTGTATAT
 
. : . : . : . : . : . :
rJMSF039P06+ ATTGCAAGATGGTTATGGAACTCTAATCCTCTTGTGTTATACAAGCTATGTTATTTTAGA
rJMFF047P17+ ATTGCAAGATGGTTATGGAACTCTAATCCTCTTGTGTTATACAAGCTATGTTATTT
rJMSF039M15+ ATTGCAAGATGGTTATGGAACTCTAATCCTCTTGTGTTATACAAGCTATGTTATTTTAGA
                      ____________________________________________________________
consensus ATTGCAAGATGGTTATGGAACTCTAATCCTCTTGTGTTATACAAGCTATGTTATTTTAGA
 
. : . : . : . : . : . :
rJMSF039P06+ ATGTATTTGTACATATTTAAGTTGTGTATATCCTTCACATGTAAATATCCCAT
rJMSF039M15+ ATGTATTTGTACATATTTAAGTTGTGTATATCCTTCACATGTAAATATCCCATTGTATCT
                      ____________________________________________________________
consensus ATGTATTTGTACATATTTAAGTTGTGTATATCCTTCACATGTAAATATCCCATTGTATCT