Previous Contig 013243:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF039M05Sequence602013243 (4)903013243 (4)pir|T47399|T473993e-54nodulin-like protein - Arabidopsis thaliana>gb:ATF23N14_1549788 Arabidopsis thal
JMSF045H02Sequence728013243 (4)pir|T47399|T473992e-45nodulin-like protein - Arabidopsis thaliana>gb:ATF23N14_1549788 Arabidopsis thal825013243 (4)pir|T47399|T473993e-54nodulin-like protein - Arabidopsis thaliana>gb:ATF23N14_1549788 Arabidopsis thal

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039M05- GGTGGAGTTGAGGGTTAGAGATTTCGCCTTTTGAGGG
                      ____________________________________________________________
consensus GGTGGAGTTGAGGGTTAGAGATTTCGCCTTTTGAGGG
 
. : . : . : . : . : . :
JMSF039M05- TGAGAATAAGCTTTTCCTGGCTATAGATATCCTAGTAGAAGCTGTGTGCATGCATAGAAC
                      ____________________________________________________________
consensus TGAGAATAAGCTTTTCCTGGCTATAGATATCCTAGTAGAAGCTGTGTGCATGCATAGAAC
 
. : . : . : . : . : . :
JMSF039M05- CAGGGTGTGAGGTTCGGAGGTCAGGGATTTCATCTTTAATTTTGAGGGTGAGAATAAGCT
                      ____________________________________________________________
consensus CAGGGTGTGAGGTTCGGAGGTCAGGGATTTCATCTTTAATTTTGAGGGTGAGAATAAGCT
 
. : . : . : . : . : . :
JMSF039M05- TTTCTTGATTATAAATATGAAGCTATGTGAACCAGGGTGTGAGGTTCGGGGATCAGGGAT
                      ____________________________________________________________
consensus TTTCTTGATTATAAATATGAAGCTATGTGAACCAGGGTGTGAGGTTCGGGGATCAGGGAT
 
. : . : . : . : . : . :
JMSF039M05- TTCACCTTTTGAAGTTGAGAATAAGATTTTCTTGGCTTAAATACCCTAGGAGAAGCTGTG
                      ____________________________________________________________
consensus TTCACCTTTTGAAGTTGAGAATAAGATTTTCTTGGCTTAAATACCCTAGGAGAAGCTGTG
 
. : . : . : . : . : . :
JMSF039M05- TGGCAACCACACTCTTATTCATCTACTCCTTTAATAATTTAGCTTTATTTAATTCATCTT
                      ____________________________________________________________
consensus TGGCAACCACACTCTTATTCATCTACTCCTTTAATAATTTAGCTTTATTTAATTCATCTT
 
. : . : . : . : . : . :
JMSF039M05- CTGAAGGGGAAAATAAGCTTTTCTTGGCTATAAATACCCTAGGAGAAGCTGTGTGGCAGC
                      ____________________________________________________________
consensus CTGAAGGGGAAAATAAGCTTTTCTTGGCTATAAATACCCTAGGAGAAGCTGTGTGGCAGC
 
. : . : . : . : . : . :
JMSF039M05- CACACTCTCATTCATCTACTCCTTTAATAATTTAGCTTTATTTAATTCATTTTCTTCATA
JMSF045H02- ACACTCTCATTCATCTACTCCTTTAATAATTTAGCTTTATTTAATTCATTTTCTTCATA
                      ____________________________________________________________
consensus CACACTCTCATTCATCTACTCCTTTAATAATTTAGCTTTATTTAATTCATTTTCTTCATA
 
. : . : . : . : . : . :
JMSF039M05- TACACAATTAAGCTAGCTTGTTCTTGTTCTTGTTCTTGTTGTTCCATGGCGGCTTCTAAC
JMSF045H02- TACACAATTAAGCTAGCTTGTTCTTGTTCTTGTTCTTGTTGTTCCATGGCGGCTTCTAAC
rJMSF039M05+ AAC
                      ____________________________________________________________
consensus TACACAATTAAGCTAGCTTGTTCTTGTTCTTGTTCTTGTTGTTCCATGGCGGCTTCTAAC
 
. : . : . : . : . : . :
JMSF039M05- CATGCATTCCAGCAAG-AACCCAAGCATGTTGTCCCTAACAATGGCGACGACATGGAGCA
JMSF045H02- CATGCATTCCAGCAAG-AACCCAAGCATGTTGTCCCTAACAATGGCGACGACATGGAGCA
rJMSF045H02+ GACATGGAGCA
rJMSF039M05+ CATGCATTCCAGCAAGNACCCCAAGCATGTTGTCCCTAACAATGGCGACGACATGGAGCA
                      ____________________________________________________________
consensus CATGCATTCCAGCAAG-AACCCAAGCATGTTGTCCCTAACAATGGCGACGACATGGAGCA
 
. : . : . : . : . : . :
JMSF039M05- ACAAGCGAGATCCCTGGATGAAGAGG
JMSF045H02- ACAAGCGAGATCCCTGGATGAAGAGGATAAGAAAGGGGGATTTGATTACGCGAAGCGGGC
rJMSF045H02+ ACCAGCGAGATCCCTGGATGAAGAGGATAAGAAAGGGGGATTTGATTACGCGAAGCGGGC
rJMSF039M05+ ACAAGCGAGATCCCTGGATGAAGAGGATAAGAAAGGGGGATTTGATTACGCGAAGCGGGC
                      ____________________________________________________________
consensus ACAAGCGAGATCCCTGGATGAAGAGGATAAGAAAGGGGGATTTGATTACGCGAAGCGGGC
 
. : . : . : . : . : . :
JMSF045H02- GCCGTGGCTGCGCGCGGCGGTTCTGGGAGCCAACGATGGATTGGTTTCCATAGCTTCTTT
rJMSF045H02+ GCCGTGGCTGCGCGCGGCGGTTCTGGGAGCCAACGATGGATTGGTTTCCATAGCTTCTTT
rJMSF039M05+ GCCGTGGCTGCGCGCGGCGGTTCTGGGAGCCAACGATGGATTGGTTTCCATAGCTTCTTT
                      ____________________________________________________________
consensus GCCGTGGCTGCGCGCGGCGGTTCTGGGAGCCAACGATGGATTGGTTTCCATAGCTTCTTT
 
. : . : . : . : . : . :
JMSF045H02- GATGATGGGTGTTGGGACGGTGAAGCAGGACATCAAGGCCATGATCCTGACCGGGTTTGC
rJMSF045H02+ GATGATGGGTGTTGGGACGGTGAAGCAGGACATCAAGGCCATGATCCTGACCGGGTTTGC
rJMSF039M05+ GATGATGGGTGTTGGGACGGTGAAGCAGGACATCAAGGCCATGATCCTGACCGGGTTTGC
                      ____________________________________________________________
consensus GATGATGGGTGTTGGGACGGTGAAGCAGGACATCAAGGCCATGATCCTGACCGGGTTTGC
 
. : . : . : . : . : . :
JMSF045H02- CGGCATGGTGGCCGGCGCGTGCTCCATGGCCATCGGAGAGTTCGTCTCCGTATATTCACA
rJMSF045H02+ CGGCATGGTGGCCGGCGCGTGCTCCATGGCCATCGGAGAGTTCGTCTCCGTATATTCACA
rJMSF039M05+ CGGCATGGTGGCCGGCGCGTGCTCCATGGCCATCGGAGAGTTCGTCTCCGTATATTCACA
                      ____________________________________________________________
consensus CGGCATGGTGGCCGGCGCGTGCTCCATGGCCATCGGAGAGTTCGTCTCCGTATATTCACA
 
. : . : . : . : . : . :
JMSF045H02- GCGCGACATAGAGGTTGCGCAGATGAAGAGGAAGAAGAACAGGCGCAACGGGGAGGACGC
rJMSF045H02+ GCGCGACATAGAGGTTGCGCAGATGAAGAGGAAGAAGAACAGGCGCAACGGGGAGGACGC
rJMSF039M05+ GCGCGACATAGAGGTTGCGCAGATGAAGAGGAAGAAGAACAGGCGCAACGGGGAGGACGC
                      ____________________________________________________________
consensus GCGCGACATAGAGGTTGCGCAGATGAAGAGGAAGAAGAACAGGCGCAACGGGGAGGACGC
 
. : . : . : . : . : . :
JMSF045H02- CGGGGAAGAAGAAGAGGAAGAGAGTGACGTCGACGAGTTGCCGAATCCCATGCAGGCGGC
rJMSF045H02+ CGGGGAAGAAGAAGAGGAAGAGAGTGACGTCGACGAGTTGCCGAATCCCATGCAGGCGGC
rJMSF039M05+ CGGGGAAGAAGAAGAGGAAGAGAGTGACGTCGACGAGTTGCCGAATCCCATGCAGGCGGC
                      ____________________________________________________________
consensus CGGGGAAGAAGAAGAGGAAGAGAGTGACGTCGACGAGTTGCCGAATCCCATGCAGGCGGC
 
. : . : . : . : . : . :
JMSF045H02- GGCGGCATCGGTGGTTGCTTTCACAATGGGCGCAATGGTGCCCTTGCTGGCGGCGTCGTT
rJMSF045H02+ GGCGGCATCGGTGGTTGCTTTCACAATGGGCGCAATGGTGCCCTTGCTGGCGGCGTCGTT
rJMSF039M05+ GGCGGCATCGGTGGTTGCTTTCACAATGGGCGCAATGGTGCCCTTGCTGGCGGCGTCGTT
                      ____________________________________________________________
consensus GGCGGCATCGGTGGTTGCTTTCACAATGGGCGCAATGGTGCCCTTGCTGGCGGCGTCGTT
 
. : . : . : . : . : . :
JMSF045H02- CATAAAGCCTTACAAGGTGAGGATTGGGGCGGTGATTGCGGCCGTCACCGTCGCTCTGGT
rJMSF045H02+ CATAAAGCCTTACAAGGTGAGGATTGGGGCGGTGATTGCGGCCGTCACCGTCGCTCTGGT
rJMSF039M05+ CATAAAGCCTTACAAGGTGAGGATTGGGGCGGTGATTGCGGCCGTCACCGTCGCTCTGGT
                      ____________________________________________________________
consensus CATAAAGCCTTACAAGGTGAGGATTGGGGCGGTGATTGCGGCCGTCACCGTCGCTCTGGT
 
. : . : . : . : . : . :
JMSF045H02- GGTTTGTGGGTGGCTTGGGGCGGCATTAGGCGGTGCACCTAAGGGTAAAGCCTCAGTTAN
rJMSF045H02+ GGTTTGTGGGTGGCTTGGGGCGGCATTAGGCGGTGCACCTAAGGGTAAAGCCTCAGTTAG
rJMSF039M05+ GGTTTGTGGGTGGCTTGGGGCGGCATTAGGCGGTGCACCTAAGGGTAAAGCCTCAGTTAG
                      ____________________________________________________________
consensus GGTTTGTGGGTGGCTTGGGGCGGCATTAGGCGGTGCACCTAAGGGTAAAGCCTCAGTTAG
 
. : . : . : . : . : . :
JMSF045H02- GGTTTTGAT
rJMSF045H02+ GGTTTTGATTGGCGGGTGGCTTGCCATGGCTATAACATCTGGATTAACAAAGTTGATTGG
rJMSF039M05+ GGTTTTGATTGGCGGGTGGCTTGCCATGGCTATAACATCTGGATTAACAAAGTTGATTGG
                      ____________________________________________________________
consensus GGTTTTGATTGGCGGGTGGCTTGCCATGGCTATAACATCTGGATTAACAAAGTTGATTGG
 
. : . : . : . : . : . :
rJMSF045H02+ TATAAAAAGCTAATTAAGCAAATAAAAATAATCCATCAACTTAACGTACATATATATAGC
rJMSF039M05+ TATAAAAAGCTAATTAAGCAAATAAAAATAATCCATCAACTTAACGTACATATATATAGC
                      ____________________________________________________________
consensus TATAAAAAGCTAATTAAGCAAATAAAAATAATCCATCAACTTAACGTACATATATATAGC
 
. : . : . : . : . : . :
rJMSF045H02+ TTGTATATTTCTCCTGTATTCTCATCCATTTCTTTACAGTTTACATGGTAAGAGATCAGA
rJMSF039M05+ TTGTATATTTCTCCTGTATTCTCATCCATTTCTTTACAGTTTACATGGTAAGAGATCAGA
                      ____________________________________________________________
consensus TTGTATATTTCTCCTGTATTCTCATCCATTTCTTTACAGTTTACATGGTAAGAGATCAGA
 
. : . : . : . : . : . :
rJMSF045H02+ CAAATCAGCCAAGGATGACGTAGGTTTAATGATCAAATATAGCAGACTAATAATGTCATA
rJMSF039M05+ CAAATCAGCCAAGGATGACGTAGGTTTAATGATCAAATATAGCAGACTAATAATGTCATA
                      ____________________________________________________________
consensus CAAATCAGCCAAGGATGACGTAGGTTTAATGATCAAATATAGCAGACTAATAATGTCATA
 
. : . : . : . : . : . :
rJMSF045H02+ TATGTATGGCACCTCAATCCATATGTGTAATATA
rJMSF039M05+ TATGTATGGCACCTCAATCCATATGTGTAATATATATAATGCATGTTTTTTCATCTCATG
                      ____________________________________________________________
consensus TATGTATGGCACCTCAATCCATATGTGTAATATATATAATGCATGTTTTTTCATCTCATG