Previous Contig 013235:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF011N01Sequence426003593 (14)gb:AF316412_17855367e-23Helianthus annuus resistance gene analog NBS7 (NBS7) gene, partial cds.769013235 (3)
JMSF024L20Sequence666003593 (14)gb:PDE416708_16995833e-34Populus deltoides MER locus, genomic DNA, cultivar S9-2.134013235 (3)
JMSF039K06Sequence662020028gb:AY363616_16027541e-11Malus baccata putative TIR-NBS type R protein 4 (R4) mRNA, complete cds.813013235 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039K06+ GCACCATATAATAGATGTTTGGACTTGGAAAAC
                      ____________________________________________________________
consensus GCACCATATAATAGATGTTTGGACTTGGAAAAC
 
. : . : . : . : . : . :
rJMSF011N01+ AATTGGCANCCNAGTATTCAGAANTATATTCTGTCTCANTCTCTTTTTCT
rJMSF039K06+ TACATAGCTGAATTGGCAACCAAGTATTCAGAATTATATTCTGTCTCATTCTCTTTTTCT
                      ____________________________________________________________
consensus TACATAGCTGAATTGGCAACCAAGTATTCAGAATTATATTCTGTCTCATTCTCTTTTTCT
 
. : . : . : . : . : . :
rJMSF011N01+ ANGCATGTCAATGATGACATAGCCTTTCTAAAACCTGAGGAGTTGGCTAAGAAGTTTATT
rJMSF039K06+ ATGCATGTTAATGATGACATAGCCTTTCTAAAACCTGAGGAGTTGGCTAAGAAGTTTATT
                      ____________________________________________________________
consensus ATGCATGTTAATGATGACATAGCCTTTCTAAAACCTGAGGAGTTGGCTAAGAAGTTTATT
 
. : . : . : . : . : . :
rJMSF011N01+ CCTATCACACTGCCTTTTCTAAACAGAAATACTCCTTTTGCTGTCACCTATCCTTTTCAC
rJMSF039K06+ CCTATCACACTGCCTTTTCTAAACAGAAATACTCCTTTTGCTGTCACCTATCCTTTTCAC
                      ____________________________________________________________
consensus CCTATCACACTGCCTTTTCTAAACAGAAATACTCCTTTTGCTGTCACCTATCCTTTTCAC
 
. : . : . : . : . : . :
rJMSF011N01+ ACTTGGAGTGATGATTATAATATGGGCAGATGTTTCAAATATCCTCACAACGATTCAAAC
rJMSF039K06+ ACTTGGAGTGATGATTATAATATGGGCAGATGTTTCAAATATCCTCACAATTATTCAAAC
                      ____________________________________________________________
consensus ACTTGGAGTGATGATTATAATATGGGCAGATGTTTCAAATATCCTCACAATTATTCAAAC
 
. : . : . : . : . : . :
rJMSF011N01+ AAGATCTCCATTTCTCTGGATCCCACTTGGTACAATCATAACTTTGTAGGGTTCGTTGTA
rJMSF039K06+ AAGATCTCCATTTCTCTGGATCCCACTTGGTACAATCATAACTTTGTAGGGTTCGTTGTA
                      ____________________________________________________________
consensus AAGATCTCCATTTCTCTGGATCCCACTTGGTACAATCATAACTTTGTAGGGTTCGTTGTA
 
. : . : . : . : . : . :
rJMSF011N01+ TGTTTTCGCTTTCCAATAAAAGTGAGTTGGGAGTCACACCCAGATATTCGACCTTTTAGG
rJMSF039K06+ TGTTTTCGCTTTCCAATAAAAGTGAGTTGGGAGTCACACCCAGATATTCGACCTTTTAGG
                      ____________________________________________________________
consensus TGTTTTCGCTTTCCAATAAAAGTGAGTTGGGAGTCACACCCAGATATTCGACCTTTTAGG
 
. : . : . : . : . : . :
rJMSF024L20+ CACACAAAGATAATGGAAGTGAACATCCTCTCCAA
rJMSF011N01+ CATTGTAAACTCATAACCAAACTTACACACAAAGATAATGGAAGTGAACATCCTCTCCAA
rJMSF039K06+ CATTGTAAACTCATAACCAAACTTACACACAAAGATAATGGAAGTGAACATCCTCTCCAA
                      ____________________________________________________________
consensus CATTGTAAACTCATAACCAAACTTACACACAAAGATAATGGAAGTGAACATCCTCTCCAA
 
. : . : . : . : . : . :
rJMSF024L20+ NCCGAATGTTTGATTGGCAGACTATATGATGAGGAATTTGATGATGGCTTTGACGATNCG
rJMSF011N01+ ACCGAATGTTTGATTGGCAGACTATATGATGAGGAATTTGATGATGGCTTTGACGATACG
rJMSF039K06+ ACCGAATGTTTGATTGGCAGACTATATGATGAGGAATTTGATGATGGCTTTGACGATACG
                      ____________________________________________________________
consensus ACCGAATGTTTGATTGGCAGACTATATGATGAGGAATTTGATGATGGCTTTGACGATACG
 
. : . : . : . : . : . :
rJMSF024L20+ GAACTTGTANGCTTTGCGT
rJMSF011N01+ GAACTTGTATGCTTTGCGTACATACCGTTTAGTAGTCTGTGGCCTAAATCTAAGGCTATC
rJMSF039K06+ GAACTTGTATGCTTTGCGTACATACCGTTTAGTAGTCTGTGGCCTAAATCTAAGGCTATC
                      ____________________________________________________________
consensus GAACTTGTATGCTTTGCGTACATACCGTTTAGTAGTCTGTGGCCTAAATCTAAGGCTATC
 
. : . : . : . : . : . :
rJMSF011N01+ ACGGATACTACTACTCCCAATCATTATTTGGTATTCGAGGCAGCATTTCAAGAGTTGGAA
rJMSF039K06+ ACGGATACTACTACTCCCAATCATTATTTGGTATTCGAGGCAGCATTTCAAGAGTTGGAA
                      ____________________________________________________________
consensus ACGGATACTACTACTCCCAATCATTATTTGGTATTCGAGGCAGCATTTCAAGAGTTGGAA
 
. : . : . : . : . : . :
rJMSF011N01+ TTTTCAAACCATTTCAATGCCGAAGATTGGGAAATTTCAACAGATTGGAGTTGTAGTTTG
rJMSF039K06+ TTTTCAAACCATTTCAATGCCGAAGATTGGGAAATTTCAACAGATTGGAGTTGTAGTTTG
                      ____________________________________________________________
consensus TTTTCAAACCATTTCAATGCCGAAGATTGGGAAATTTCAACAGATTGGAGTTGTAGTTTG
 
. : . : . : . : . : . :
rJMSF011N01+ CTGTATAAAGATGATAAATCATTAATTGAAGAATTACAGCGAAAAAGGGAGAATGGTTCT
rJMSF039K06+ CTGTATAAAGATGATAAATCATTAATTGAAGAATTACAGCGAAAAAGGGAGAATGGTTCT
                      ____________________________________________________________
consensus CTGTATAAAGATGATAAATCATTAATTGAAGAATTACAGCGAAAAAGGGAGAATGGTTCT
 
. : . : . : . : . : . :
rJMSF011N01+ AGCGAGAGTGATTCAGATGAAGATGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA
rJMSF039K06+ AGCGAGAGTGATTCAGATGAAGATGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAT
                      ____________________________________________________________
consensus AGCGAGAGTGATTCAGATGAAGATGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAT