Previous Contig 013232:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF039J08Sequence699013232 (3)gb:ATAC009325_15429055e-35Arabidopsis thaliana chromosome III BAC F4P13 genomic sequence, complete sequenc736013232 (3)gb:ATAC009325_15429055e-35Arabidopsis thaliana chromosome III BAC F4P13 genomic sequence, complete sequenc
JMSF040J08Sequence298006925 (3)734013232 (3)gb:ATAC009325_15429055e-35Arabidopsis thaliana chromosome III BAC F4P13 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039J08- GCTTGTACGTGAATAA
rJMSF040J08+ GCTTGTACGTGAATAA
rJMSF039J08+ GCTTGTACGTGAATAA
                      ____________________________________________________________
consensus GCTTGTACGTGAATAA
 
. : . : . : . : . : . :
JMSF039J08- CTCGTTACAGCAAAATTAGGATGATGATGATTAATGGGTTTTACGGTGGTTAACTGGTTA
rJMSF040J08+ CTCGTTACAGCAAAATTAGGATGATGATGATTAATGGGTTTTACGGTGGTTAACTGGTTA
rJMSF039J08+ CTCGTTACAGCAAAATTAGGATGATGATGATTAATGGGTTTTACGGTGGTTAACTGGTTA
                      ____________________________________________________________
consensus CTCGTTACAGCAAAATTAGGATGATGATGATTAATGGGTTTTACGGTGGTTAACTGGTTA
 
. : . : . : . : . : . :
JMSF039J08- TTATAAGGGGGCGTTTGGTTAATGTTAGTTACCAATTTCTAGAGGTACCCTCACTCACGC
rJMSF040J08+ TTATAAGGGGGCGTTTGGTTAATGTTAGTTACCAATTTCTAGAGGTACCCTCACTCACGC
rJMSF039J08+ TTATAAGGGGGCGTTTGGTTAATGTTAGTTACCAATTTCTAGAGGTACCCTCACTCACGC
                      ____________________________________________________________
consensus TTATAAGGGGGCGTTTGGTTAATGTTAGTTACCAATTTCTAGAGGTACCCTCACTCACGC
 
. : . : . : . : . : . :
JMSF039J08- CTTGCGCACCAGAGTTACTCACCATCAGCGCCTCTTCTGATACCTTTCTCCTTCCTCCCA
rJMSF040J08+ CTTGCGCACCAGAGTTACTCACCATCAGCGCCTCTTCTGATACCTTTCTCCTTCCTCCCA
rJMSF039J08+ CTTGCGCACCAGAGTTACTCACCATCAGCGCCTCTTCTGATACCTTTCTCCTTCCTCCCA
                      ____________________________________________________________
consensus CTTGCGCACCAGAGTTACTCACCATCAGCGCCTCTTCTGATACCTTTCTCCTTCCTCCCA
 
. : . : . : . : . : . :
JMSF039J08- TCAGGGTGCAAAGATATGGCAATTAGTTATATGCGGTCATTAAAAAGTGTCGTCATCCCC
rJMSF040J08+ TCAGGGTGCAAAGATATGGCAATTAGTTATATGCGGTCATTAAAAAGTGTCGTCATCCCC
rJMSF039J08+ TCAGGGTGCAAAGATATGGCAATTAGTTATATGCGGTCATTAAAAAGTGTCGTCATCCCC
                      ____________________________________________________________
consensus TCAGGGTGCAAAGATATGGCAATTAGTTATATGCGGTCATTAAAAAGTGTCGTCATCCCC
 
. : . : . : . : . : . :
JMSF039J08- AAGGAGATTGCTGGAGTAATTGGCTGCAGAACATTTGCTGCCGGAGGTGGTAAAGCAAAG
rJMSF040J08+ AAGGAGATTGCTGGAGTAATTGGCTGCAGAACATTTGCTGCCGGAGGTGGTAAAGCAAAG
rJMSF039J08+ AAGGAGATTGCTGGAGTAATTGGCTGCAGAACATTTGCTGCCGGAGGTGGTAAAGCAAAG
                      ____________________________________________________________
consensus AAGGAGATTGCTGGAGTAATTGGCTGCAGAACATTTGCTGCCGGAGGTGGTAAAGCAAAG
 
. : . : . : . : . : . :
JMSF039J08- AAGTCTAAAGGTGCAGCTGCTGATGCTCCAAAGGTGTCTTCACTCAGCAAAGAAGTGAAA
rJMSF040J08+ AAGTCTAAAGGTGCAGCTGCTGATGCTCCAAAGGTGTCTTCACTCAGCAAAGAAGTGAAA
rJMSF039J08+ AAGTCTAAAGGTGCAGCTGCTGATGCTCCAAAGGTGTCTTCACTCAGCAAAGAAGTGAAA
                      ____________________________________________________________
consensus AAGTCTAAAGGTGCAGCTGCTGATGCTCCAAAGGTGTCTTCACTCAGCAAAGAAGTGAAA
 
. : . : . : . : . : . :
JMSF039J08- GCAAGTACAGTTGTCGGTGCTAATATACTCAAGGATGGAACGGACCCTAAAGTCTTGGCC
rJMSF040J08+ GCAAGTACAGTTGTCGGTGCTAATATACTCAAGGATGGAACGGACCCTAAAGTCTTGGCC
rJMSF039J08+ GCAAGTACAGTTGTCGGTGCTAATATACTCAAGGATGGAACGGACCCTAAAGTCTTGGCC
                      ____________________________________________________________
consensus GCAAGTACAGTTGTCGGTGCTAATATACTCAAGGATGGAACGGACCCTAAAGTCTTGGCC
 
. : . : . : . : . : . :
JMSF039J08- GACTCTGAGTACCCTGAATGGCTGTGGCACTTGCTGGATAAAAAACCAGCACTTAGTGAG
rJMSF040J08+ GACTCTGAGTACCCTGAATGGCTGTGGCACTTGCTGGATAAAAAACCAGCACTTAGTGAG
rJMSF039J08+ GACTCTGAGTACCCTGAATGGCTGTGGCACTTGCTGGATAAAAAACCAGCACTTAGTGAG
                      ____________________________________________________________
consensus GACTCTGAGTACCCTGAATGGCTGTGGCACTTGCTGGATAAAAAACCAGCACTTAGTGAG
 
. : . : . : . : . : . :
JMSF039J08- CTAAGAAGGAAAGACTTAGAGACACTCCCTTACGAGGACCTCAAACGCTTTGTCAAGCTC
rJMSF040J08+ CTAAGAAGGAAAGACTTAGAGACACTCCCTTACGAGGACCTCAAACGCTTTGTCAAGCTC
rJMSF039J08+ CTAAGAAGGAAAGACTTAGAGACACTCCCTTACGAGGACCTCAAACGCTTTGTCAAGCTC
                      ____________________________________________________________
consensus CTAAGAAGGAAAGACTTAGAGACACTCCCTTACGAGGACCTCAAACGCTTTGTCAAGCTC
 
. : . : . : . : . : . :
JMSF039J08- GATAACCGAGCAAGGATCAAGGAAAATAATTCTGTTAGGGCCAAGAACTAAGTGTAGTCG
rJMSF040J08+ GATAACCGAGCAAGGATCAAGGAAAATAATTCTGTTAGGGCCAAGAACTAAGTGTAGTCG
rJMSF039J08+ GATAACCGAGCAAGGATCAAGGAAAATAATTCTGTTAGGGCCAAGAACTAAGTGTAGTCG
                      ____________________________________________________________
consensus GATAACCGAGCAAGGATCAAGGAAAATAATTCTGTTAGGGCCAAGAACTAAGTGTAGTCG
 
. : . : . : . : . : . :
JMSF039J08- ACATCAGTCCTTTCTATACTTCAATGTTTTGTTGTCATGCATCATGAAAGATAAAAGAAT
rJMSF040J08+ ACATCAGTCCTTTCTATACTTCAATGTTTTGTTGTCATGCATCATGAAAGATAAAAGAAT
rJMSF039J08+ ACATCAGTCCTTTCTATACTTCAATGTTTTGTTGTCATGCATCATGAAAGATAAAAGAAT
                      ____________________________________________________________
consensus ACATCAGTCCTTTCTATACTTCAATGTTTTGTTGTCATGCATCATGAAAGATAAAAGAAT
 
. : . : . : . : . : . :
JMSF039J08- TTGTATGAATTATGATGGTTGAA
rJMSF040J08+ TTGTATGAATTATGATGGTTGAAATTTTGCTGTGTTGAAGTAGACAACAC
rJMSF039J08+ TTGTATGAATTATGATGGTTGAAATTTTGCTGTGTTGAAGTAGACAACACCAAGCGTTTC
                      ____________________________________________________________
consensus TTGTATGAATTATGATGGTTGAAATTTTGCTGTGTTGAAGTAGACAACACCAAGCGTTTC