Previous Contig 013231:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF039J05Sequence660013231 (2)gb:AY084835_15699181e-97Arabidopsis thaliana clone 119092 mRNA, complete sequence.865013231 (2)gb:AY084835_15699186e-98Arabidopsis thaliana clone 119092 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039J05- GGATCGACGATTGCTGGCGTTGCGACTCCAATTGGCAGT
                      ____________________________________________________________
consensus GGATCGACGATTGCTGGCGTTGCGACTCCAATTGGCAGT
 
. : . : . : . : . : . :
JMSF039J05- TGAACCGGCAGCGGCTGGCGGACTGCGGCATTGGGTTCGGGCAATACGCCGTCGGCGGGA
                      ____________________________________________________________
consensus TGAACCGGCAGCGGCTGGCGGACTGCGGCATTGGGTTCGGGCAATACGCCGTCGGCGGGA
 
. : . : . : . : . : . :
JMSF039J05- AGGGCGGGCGTTACTACGTGGTCACCGACTCGTCGGACCCGGACCCGGTGAACCCGCCGC
                      ____________________________________________________________
consensus AGGGCGGGCGTTACTACGTGGTCACCGACTCGTCGGACCCGGACCCGGTGAACCCGCCGC
 
. : . : . : . : . : . :
JMSF039J05- CGGGGACTCTCCGCTACGGCGTGATCCAAACGGAGCCGCTGTGGATCGTGTTCGCCGCCA
                      ____________________________________________________________
consensus CGGGGACTCTCCGCTACGGCGTGATCCAAACGGAGCCGCTGTGGATCGTGTTCGCCGCCA
 
. : . : . : . : . : . :
JMSF039J05- GCATGGTCATCCAGCTCTCGGAGGAGCTCATATTCAACTCCTACAAGACCCTCGACGGCC
                      ____________________________________________________________
consensus GCATGGTCATCCAGCTCTCGGAGGAGCTCATATTCAACTCCTACAAGACCCTCGACGGCC
 
. : . : . : . : . : . :
JMSF039J05- GCGGCGCCAACGTCCACATCACCGGCGGCGGCTGCATAACGTTGCAGTACATTTCCAACG
                      ____________________________________________________________
consensus GCGGCGCCAACGTCCACATCACCGGCGGCGGCTGCATAACGTTGCAGTACATTTCCAACG
 
. : . : . : . : . : . :
JMSF039J05- TCATCATCCACAACATTCACATCCACCATTGTTACCAGTCCGGCGAGACCAATATCCGGT
                      ____________________________________________________________
consensus TCATCATCCACAACATTCACATCCACCATTGTTACCAGTCCGGCGAGACCAATATCCGGT
 
. : . : . : . : . : . :
JMSF039J05- CCAGTCCCACTCACTTCGGGTGGCGAACCTTGTCGGACGGCGACGGGATATCCATCTTCG
rJMSF039J05+ GACGGCGACGGGATATCCATCTTCG
                      ____________________________________________________________
consensus CCAGTCCCACTCACTTCGGGTGGCGAACCTTGTCGGACGGCGACGGGATATCCATCTTCG
 
. : . : . : . : . : . :
JMSF039J05- GGTCGAGGGACATATGGATCGATCACTGCTCTCTCTCGCACTGCAAGGACGGGCTGATCG
rJMSF039J05+ GGTCGAGGGACATATGGATCGATCACTGCTCTCTCTCGCACTGCAAGGACGGGCTGATCG
                      ____________________________________________________________
consensus GGTCGAGGGACATATGGATCGATCACTGCTCTCTCTCGCACTGCAAGGACGGGCTGATCG
 
. : . : . : . : . : . :
JMSF039J05- ACGCCGTGATGGGTTCCACCGGAATCACCATATCCAACAACCACTTCTCCCACCATAACG
rJMSF039J05+ ACGCCGTGATGGGTTCCACCGGAATCACCATATCCAACAACCACTTCTCCCACCATAACG
                      ____________________________________________________________
consensus ACGCCGTGATGGGTTCCACCGGAATCACCATATCCAACAACCACTTCTCCCACCATAACG
 
. : . : . : . : . : . :
JMSF039J05- AGGTGATGTTGTTGGGTCACAGCGACGATTACTTGCCGGACTCCGGCATGCAAGTCACCA
rJMSF039J05+ AGGTGATGTTGTTGGGTCACAGCGACGATTACTTGCCGGACTCCGGCATGCAAGTCACCA
                      ____________________________________________________________
consensus AGGTGATGTTGTTGGGTCACAGCGACGATTACTTGCCGGACTCCGGCATGCAAGTCACCA
 
. : . : . : . : . : . :
JMSF039J05- TTGCGTTTAACCACTTCGGGA
rJMSF039J05+ TTGCGTTTAACCACTTCGGGAAGAAGCTTATTCAGAGAATGCCGAGGTGTAGGCGAGGGT
                      ____________________________________________________________
consensus TTGCGTTTAACCACTTCGGGAAGAAGCTTATTCAGAGAATGCCGAGGTGTAGGCGAGGGT
 
. : . : . : . : . : . :
rJMSF039J05+ ATATCCATGTAGTGAACAATGATTTCACGAGGTGGGAGATGTACGCCATTGGAGGGAGCG
                      ____________________________________________________________
consensus ATATCCATGTAGTGAACAATGATTTCACGAGGTGGGAGATGTACGCCATTGGAGGGAGCG
 
. : . : . : . : . : . :
rJMSF039J05+ GCAATCCTACCATCAATAGTCAAGGAAATCGGTACATTGCACCCTTTGACCGCAACGCCA
                      ____________________________________________________________
consensus GCAATCCTACCATCAATAGTCAAGGAAATCGGTACATTGCACCCTTTGACCGCAACGCCA
 
. : . : . : . : . : . :
rJMSF039J05+ AAGAGGTGACAAAAAGAGTGGACACATCAGAAGAAAAGTGGCGGAACTGGAATTGGAGGA
                      ____________________________________________________________
consensus AAGAGGTGACAAAAAGAGTGGACACATCAGAAGAAAAGTGGCGGAACTGGAATTGGAGGA
 
. : . : . : . : . : . :
rJMSF039J05+ GCGAGGGGGACGTAATGGCAAACGGAGCCTACTTTGTAGCTTCGGGTGAGGAATTGGAAG
                      ____________________________________________________________
consensus GCGAGGGGGACGTAATGGCAAACGGAGCCTACTTTGTAGCTTCGGGTGAGGAATTGGAAG
 
. : . : . : . : . : . :
rJMSF039J05+ TGAAATATGAGAAAGCGTACAGTGTGGAACCCAAATCTGCTAATTTCCTTGACCAAATCA
                      ____________________________________________________________
consensus TGAAATATGAGAAAGCGTACAGTGTGGAACCCAAATCTGCTAATTTCCTTGACCAAATCA
 
. : . : . : . : . : . :
rJMSF039J05+ CCATGAACGCCGGCGTTCTTGTTGGCAGGGGGAGGAGCAGCGGCAAGTGGACTGCTGCTG
                      ____________________________________________________________
consensus CCATGAACGCCGGCGTTCTTGTTGGCAGGGGGAGGAGCAGCGGCAAGTGGACTGCTGCTG
 
. : . : . : . : . : . :
rJMSF039J05+ GGAATGTCACCGCCGGCGGCGATGATGACGGGAACTACTTGATGGCAATTTCCGGCGACC
                      ____________________________________________________________
consensus GGAATGTCACCGCCGGCGGCGATGATGACGGGAACTACTTGATGGCAATTTCCGGCGACC
 
. : . : . : . : . : . :
rJMSF039J05+ CGGACGACTACGATGGCGATTACGCCGGGGGCTACATGCTTTGCCCCAACTCCATTCTCT
                      ____________________________________________________________
consensus CGGACGACTACGATGGCGATTACGCCGGGGGCTACATGCTTTGCCCCAACTCCATTCTCT
 
. : . : . : . : . : . :
rJMSF039J05+ TGTATTATCTGCTAGCCATGTTAACCTTCATGTTATTGTAGTAAGAATTCAAGAGGAAAG
                      ____________________________________________________________
consensus TGTATTATCTGCTAGCCATGTTAACCTTCATGTTATTGTAGTAAGAATTCAAGAGGAAAG
 
. : . : . : . : . : . :
rJMSF039J05+ CCCGTACGAGCTTAACTCACTGATTCAGTAGGCAGTATTTGAGAAAAGAAGAATTCAAGA
                      ____________________________________________________________
consensus CCCGTACGAGCTTAACTCACTGATTCAGTAGGCAGTATTTGAGAAAAGAAGAATTCAAGA