Previous Contig 013219:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF039H03Sequence701020018863013219 (2)pir|T01925|T019251e-64hypothetical protein F2P3.4 - Arabidopsis thaliana>gb:ATCHRIV31_1544874 Arabidop
JMSF040H03Sequence507013219 (2)gb:AY142519_15829485e-22Arabidopsis thaliana unknown protein (At4g23790) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039H03+ GAGGACATAAATGGGGTATCTTC
                      ____________________________________________________________
consensus GAGGACATAAATGGGGTATCTTC
 
. : . : . : . : . : . :
rJMSF039H03+ TTNTGAGATCGAGCTGCATCTTGATAGACTTGATAAGAATTGGACTCGGTATTATGATGA
                      ____________________________________________________________
consensus TTNTGAGATCGAGCTGCATCTTGATAGACTTGATAAGAATTGGACTCGGTATTATGATGA
 
. : . : . : . : . : . :
rJMSF039H03+ GTTAGACTACATAGTATTCTCGAGTGGCGAGTGGTTTGTGAAAACGGCTGTCTATTTCAA
                      ____________________________________________________________
consensus GTTAGACTACATAGTATTCTCGAGTGGCGAGTGGTTTGTGAAAACGGCTGTCTATTTCAA
 
. : . : . : . : . : . :
rJMSF039H03+ GAACGATATGATAATAGGGTGCCACCTTTGTCCCAAAAGGAACTTGACAGAGCTCGGGTT
                      ____________________________________________________________
consensus GAACGATATGATAATAGGGTGCCACCTTTGTCCCAAAAGGAACTTGACAGAGCTCGGGTT
 
. : . : . : . : . : . :
rJMSF039H03+ CGCCTTTGCCTACAGAGAAATCCTCAGGAGTTTCTTCAACTACATTATTTCGTCGAAGCA
                      ____________________________________________________________
consensus CGCCTTTGCCTACAGAGAAATCCTCAGGAGTTTCTTCAACTACATTATTTCGTCGAAGCA
 
. : . : . : . : . : . :
rJMSF040H03+ ATTTCGAGCATGGNGAATGGTT
rJMSF039H03+ TAAAGGTACGATTTTGTTTAGGACCACCACCCCAGCCCATTTCGAGCATGGCGAATGGTT
                      ____________________________________________________________
consensus TAAAGGTACGATTTTGTTTAGGACCACCACCCCAGCCCATTTCGAGCATGGCGAATGGTT
 
. : . : . : . : . : . :
rJMSF040H03+ TAGCGGGGNGACNTGCAACAGAACAGANCCAGCACACGAAGGCGAGTTCAAGTTAAGTGA
rJMSF039H03+ TAGCGGGGGGACCTGCAACAGAACAGAGCCAGCACACGAAGGCGAGTTCAAGTTAAGTGA
                      ____________________________________________________________
consensus TAGCGGGGGGACCTGCAACAGAACAGAGCCAGCACACGAAGGCGAGTTCAAGTTAAGTGA
 
. : . : . : . : . : . :
rJMSF040H03+ GATTCACAGGATTCTGCGAGAGGTGGAGCTGCAGGAATTNGAGAGGGTNTCGGGCAATGC
rJMSF039H03+ GATTCACAGGATTCTGCGAGAGGTGGAGCTGCAGGAATTCGAGAGGGTCTCGGGCAATGC
                      ____________________________________________________________
consensus GATTCACAGGATTCTGCGAGAGGTGGAGCTGCAGGAATTCGAGAGGGTCTCGGGCAATGC
 
. : . : . : . : . : . :
rJMSF040H03+ AACCGAGGCGGGGGTGAAGCTTAAGCTCTTNGACATAACTCCCCTCACGTTGTTGAGGCC
rJMSF039H03+ AACCGAGGCGGGGGTGAAGCTTAAGCTCTTCGACATAACTCCCCTCACGTTGTTGAGGCC
                      ____________________________________________________________
consensus AACCGAGGCGGGGGTGAAGCTTAAGCTCTTCGACATAACTCCCCTCACGTTGTTGAGGCC
 
. : . : . : . : . : . :
rJMSF040H03+ CGATGGCCACCCGGGGCCATACAGATTNTATCAACCGTTTGCGGATGGCAAGAACGGGAC
rJMSF039H03+ CGATGGCCACCCGGGGCCATACAGATTCTATCAACCGTTTGCGGATGGCAAGAACGGGAC
                      ____________________________________________________________
consensus CGATGGCCACCCGGGGCCATACAGATTCTATCAACCGTTTGCGGATGGCAAGAACGGGAC
 
. : . : . : . : . : . :
rJMSF040H03+ AGGCATCAACGACTGCCTGCACTGGNGCTTGCCCGGGCCGATTGATTCTNGGAACGATTT
rJMSF039H03+ AGGCATCAACGACTGCCTGCACTGGTGCTTGCCCGGGCCGATTGATTCTTGGAACGATTT
                      ____________________________________________________________
consensus AGGCATCAACGACTGCCTGCACTGGTGCTTGCCCGGGCCGATTGATTCTTGGAACGATTT
 
. : . : . : . : . : . :
rJMSF040H03+ GCTAATGGAAATGGTTAGGTGCCGTTGAGAGGGTATTTGGTCATTCTTTTCTGACATTCA
rJMSF039H03+ GCTAATGGAAATGGTTAGGTGCCGTTGAGAGGGTATTTGGTCATTCTTTTCTGACATTCA
                      ____________________________________________________________
consensus GCTAATGGAAATGGTTAGGTGCCGTTGAGAGGGTATTTGGTCATTCTTTTCTGACATTCA
 
. : . : . : . : . : . :
rJMSF040H03+ AAACCTCGTTCGCTTGCAGTCTGCCATGAATGAATGCTTCGGGGAAAGTATCGATTGATG
rJMSF039H03+ AAACCTCGTTCGCTTGCAGTCTGCCATGAATGAATGCTTCGGGGAAAGTATCGATTGATG
                      ____________________________________________________________
consensus AAACCTCGTTCGCTTGCAGTCTGCCATGAATGAATGCTTCGGGGAAAGTATCGATTGATG
 
. : . : . : . : . : . :
rJMSF040H03+ GATCGAAATGGTTAGTGATGCAAGTAATTAAAGCTCATATTATAGTAATNGTCTGCAACT
rJMSF039H03+ GATCGAAATGGTTAGTGATGCAAGTAATTAAAGCACATATTATAGTAATGGTCTGCAACT
                      ____________________________________________________________
consensus GATCGAAATGGTTAGTGATGCAAGTAATTAAAGCTCATATTATAGTAATGGTCTGCAACT
 
. : . : . : . : . : . :
rJMSF040H03+ CTTTC
rJMSF039H03+ CTTTCTACCCCTCTGTAGGTTTATGTATAAAAAACAGTAATACTAAATNGGAGATGGCAC
                      ____________________________________________________________
consensus CTTTCTACCCCTCTGTAGGTTTATGTATAAAAAACAGTAATACTAAATNGGAGATGGCAC