Previous Contig 013210:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF026O05Sequence688003253 (5)pir|T51353|T513535e-63NAD ADP-ribosyltransferase (EC 2.4.2.30) [imported] - Arabidopsis thaliana>gb:AT689013210 (3)pir|T51353|T513531e-75NAD ADP-ribosyltransferase (EC 2.4.2.30) [imported] - Arabidopsis thaliana>gb:AT
JMSF037M20Sequence624003253 (5)pir|T51353|T513532e-59NAD ADP-ribosyltransferase (EC 2.4.2.30) [imported] - Arabidopsis thaliana>gb:AT652013210 (3)pir|T51353|T513533e-79NAD ADP-ribosyltransferase (EC 2.4.2.30) [imported] - Arabidopsis thaliana>gb:AT
JMSF039E03Sequence674003253 (5)pir|T51353|T513533e-60NAD ADP-ribosyltransferase (EC 2.4.2.30) [imported] - Arabidopsis thaliana>gb:AT824013210 (3)pir|T51353|T513531e-96NAD ADP-ribosyltransferase (EC 2.4.2.30) [imported] - Arabidopsis thaliana>gb:AT

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039E03+ TACTCGTGACTCTGAAGATTTCCGGCTGGTTGAGAAGTATCTCC
                      ____________________________________________________________
consensus TACTCGTGACTCTGAAGATTTCCGGCTGGTTGAGAAGTATCTCC
 
. : . : . : . : . : . :
rJMSF039E03+ AAGCTACTCATGCTCCCACACATAAGGAATGGGCTCTTGAAGTGGAACAAGTGTTTTCTC
                      ____________________________________________________________
consensus AAGCTACTCATGCTCCCACACATAAGGAATGGGCTCTTGAAGTGGAACAAGTGTTTTCTC
 
. : . : . : . : . : . :
rJMSF026O05+ CTCCCTTCAGAAAGAAATTGAAGAATAGAA
rJMSF037M20+ AAAGGGGAACTTGACAAATTTGCTCCCTTCAGAAAGAAATTGAAGAATAGAA
rJMSF039E03+ TTGAACGCAAAGGGGAACTTGACAAATTTGCTCCCTTCAGAAAGAAATTGAAGAATAGAA
                      ____________________________________________________________
consensus TTGAACGCAAAGGGGAACTTGACAAATTTGCTCCCTTCAGAAAGAAATTGAAGAATAGAA
 
. : . : . : . : . : . :
rJMSF026O05+ TGCTTTTATGGCACGGTTCACGGTTGACGAACTTTGTTGGTATACTTAGCCAAGGACTAA
rJMSF037M20+ TGCTTTTATGGCACGGTTCACGGTTGACGAACTTTGTTGGTATACTTAGCCAAGGACTAA
rJMSF039E03+ TGCTTTTATGGCACGGTTCACGGTTGACGAACTTTGTTGGTATACTTAGCCAAGGACTAA
                      ____________________________________________________________
consensus TGCTTTTATGGCACGGTTCACGGTTGACGAACTTTGTTGGTATACTTAGCCAAGGACTAA
 
. : . : . : . : . : . :
rJMSF026O05+ GGATTGCTCCTCCTGAAGCCCCAACTACTGGCTATATGTTTGGCAAAGGAGTTTACTTTG
rJMSF037M20+ GGATTGCTCCTCCTGAAGCCCCAACTACTGGCTATATGTTTGGCAAAGGAGTTTACTTTG
rJMSF039E03+ GGATTGCTCCTCCTGAAGCCCCAACTACTGGCTATATGTTTGGCAAAGGAGTTTACTTTG
                      ____________________________________________________________
consensus GGATTGCTCCTCCTGAAGCCCCAACTACTGGCTATATGTTTGGCAAAGGAGTTTACTTTG
 
. : . : . : . : . : . :
rJMSF026O05+ CTGACATGGTCAGTAAGAGTGCTCAGTATTGTTTTACAAACCGTAAAAATCCTGTGGGCT
rJMSF037M20+ CTGACATGGTCAGTAAGAGTGCTCAGTATTGTTTTACAAACCGTAAAAATCCTGTGGGCT
rJMSF039E03+ CTGACATGGTCAGTAAGAGTGCTCAGTATTGTTTTACAAACCGTAAAAATCCTGTGGGCT
                      ____________________________________________________________
consensus CTGACATGGTCAGTAAGAGTGCTCAGTATTGTTTTACAAACCGTAAAAATCCTGTGGGCT
 
. : . : . : . : . : . :
rJMSF026O05+ TTATGCTACTCAGTGAAGTTGCATTGGGAGACATGCACGAGCTTAAAAAGGCTCAGTACA
rJMSF037M20+ TTATGCTACTCAGTGAAGTTGCATTGGGAGACATGCACGAGCTTAAAAAGGCTCAGTACA
rJMSF039E03+ TTATGCTACTCAGTGAAGTTGCATTGGGAGACATGCACGAGCTTAAAAAGGCTCAGTACA
                      ____________________________________________________________
consensus TTATGCTACTCAGTGAAGTTGCATTGGGAGACATGCACGAGCTTAAAAAGGCTCAGTACA
 
. : . : . : . : . : . :
rJMSF026O05+ TGGACAAGCCCCCGAAAGGGAAGCACTCTACTAAAGGTCTGGGTAAGACAGTACCTCAAG
rJMSF037M20+ TGGACAAGCCCCCGAAAGGGAAGCACTCTACTAAAGGTCTGGGTAAGACAGTACCTCAAG
rJMSF039E03+ TGGACAAGCCCCCGAAAGGGAAGCACTCTACTAAAGGTCTGGGTAAGACAGTACCTCAAG
                      ____________________________________________________________
consensus TGGACAAGCCCCCGAAAGGGAAGCACTCTACTAAAGGTCTGGGTAAGACAGTACCTCAAG
 
. : . : . : . : . : . :
rJMSF026O05+ AATCAGACTATGTGAAGTGGCGGGATGAAGTAGTTGTACCTTGTGGAAAACCAGTGCCAT
rJMSF037M20+ AATCAGACTATGTGAAGTGGCGGGATGAAGTAGTTGTACCTTGTGGAAAACCAGTGCCAT
rJMSF039E03+ AATCAGACTATGTGAAGTGGCGGGATGAAGTAGTTGTACCTTGTGGAAAACCAGTGCCAT
                      ____________________________________________________________
consensus AATCAGACTATGTGAAGTGGCGGGATGAAGTAGTTGTACCTTGTGGAAAACCAGTGCCAT
 
. : . : . : . : . : . :
rJMSF026O05+ CAAAAGTCAAGGCATCGGAGCTTTTATATAATGAATATATTGTTTACGACATTGCCCAGG
rJMSF037M20+ CAAAAGTCAAGGCATCGGAGCTTTTATATAATGAATATATTGTTTACGACATTGCCCAGG
rJMSF039E03+ CAAAAGTCAAGGCATCGGAGCTTTTATATAATGAATATATTGTTTACGACATTGCCCAGG
                      ____________________________________________________________
consensus CAAAAGTCAAGGCATCGGAGCTTTTATATAATGAATATATTGTTTACGACATTGCCCAGG
 
. : . : . : . : . : . :
rJMSF026O05+ TCAAGCTGCAGTTCTTAGTGAAGGTGAGGTTTCAGTACAAGTGATGAACCAAAATTCTGC
rJMSF037M20+ TCAAGCTGCAGTTCTTAGTGAAGGTGAGGTTTCAGTACAAGTGATGAACCAAAATTCTGC
rJMSF039E03+ TCAAGCTGCAGTTCTTAGTGAAGGTGAGGTTTCAGTACAAGTGATGAACCAAAATTCTGC
                      ____________________________________________________________
consensus TCAAGCTGCAGTTCTTAGTGAAGGTGAGGTTTCAGTACAAGTGATGAACCAAAATTCTGC
 
. : . : . : . : . : . :
rJMSF026O05+ ATTATTAATGTTTCTTGGAGCTGTATATAATGGTGGAACCTATGTTGGATATTCTGCTCC
rJMSF037M20+ ATTATTAATGTTTCTTGGAGCTGTATATAATGGTGGAACCTATGTTGGATATTCTGCTCC
rJMSF039E03+ ATTATTAATGTTTCTTGGAGCTGTATATAATGGTGGAACCTATGTTGGATATTCTGCTCC
                      ____________________________________________________________
consensus ATTATTAATGTTTCTTGGAGCTGTATATAATGGTGGAACCTATGTTGGATATTCTGCTCC
 
. : . : . : . : . : . :
rJMSF026O05+ TTAGTACTCTACCTTTTGAAATTGCCTGGCTGTTTGGCGCCGAATCGGTCAGATCTCATT
rJMSF037M20+ TTAGTACTCTACCTTTTGAAATTGCCTGGCTGTTTGGCGCCGAATCGGTCAGATCTCATT
rJMSF039E03+ TTAGTACTCTACCTTTTGAAATTGCCTGGCTGTTTGGCGCCGAATCGGTCAGATCTCATT
                      ____________________________________________________________
consensus TTAGTACTCTACCTTTTGAAATTGCCTGGCTGTTTGGCGCCGAATCGGTCAGATCTCATT
 
. : . : . : . : . : . :
rJMSF026O05+ TTGAGACTTCCTGGAGATCTGAGTTCTTCAATGAATGTGTAAATGGCTTTTGTATGATA
rJMSF039E03+ TTGAGACTTCCTGGAGATCTGAGTTCTTCAATGAATGTGTAAATGGCTTTTGTATGATAT
                      ____________________________________________________________
consensus TTGAGACTTCCTGGAGATCTGAGTTCTTCAATGAATGTGTAAATGGCTTTTGTATGATAT