Previous Contig 013209:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010B17Sequence571013209 (4)gb:BT002499_16361022e-28Arabidopsis thaliana putative protein (At4g30200) mRNA, complete cds.>gb:BT00842705013209 (4)gb:BT002499_16361022e-28Arabidopsis thaliana putative protein (At4g30200) mRNA, complete cds.>gb:BT00842
JMFF049I13Sequence532013209 (4)gb:BT002499_16361028e-24Arabidopsis thaliana putative protein (At4g30200) mRNA, complete cds.>gb:BT00842
JMSF039D23Sequence652020009pir|T14080|T140805e-63hypothetical protein F9N11.50 - Arabidopsis thaliana>gb:AB050977_1521054 Arabido819013209 (4)gb:BT002499_16361027e-28Arabidopsis thaliana putative protein (At4g30200) mRNA, complete cds.>gb:BT00842

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF010B17- ATTAACCTAGATGAGATGAGGTTTGCAATTGAATTGTATCCTCCTCATCGATCAGCTC
rJMSF039D23- GGTTTGCAATTGAATTGTATCCTCCTCATCGATCAGCTC
                      ____________________________________________________________
consensus ATTAACCTAGATGAGATGAGGTTTGCAATTGAATTGTATCCTCCTCATCGATCAGCTC
 
. : . : . : . : . : . :
JMFF010B17+ GATGATGGAGTTGAATT
rJMFF010B17- CTAATAAGAGAAGAGAAGAGAATAGAAAGCTAGGGGGTCTAGGGATGATGGAGTTGAATT
rJMSF039D23- CTAATAAGAGAAGAGAAGAGAATAGAAAGCTAGGGGGTCTAGGGATGATGGAGTTGAATT
                      ____________________________________________________________
consensus CTAATAAGAGAAGAGAAGAGAATAGAAAGCTAGGGGGTCTAGGGATGATGGAGTTGAATT
 
. : . : . : . : . : . :
JMFF010B17+ CAGTGCCAAAGCTTAAGGCAAAAGCCTGCAGGCACCATAGAAGACTTCTTGTTTGAGATG
JMFF049I13+ CATAGAAGACTTCTTGTTTGAGATG
rJMFF010B17- CAGTGCCAAAGCTTAAGGCAAAAGCCTGCAGGCACCATAGAAGACTTCTTGTTTGAGATG
rJMSF039D23- CAGTGCCAAAGCTTAAGGCAAAAGCCTGCAGGCACCATAGAAGACTTCTTGTTTGAGATG
                      ____________________________________________________________
consensus CAGTGCCAAAGCTTAAGGCAAAAGCCTGCAGGCACCATAGAAGACTTCTTGTTTGAGATG
 
. : . : . : . : . : . :
JMFF010B17+ ACATCTGAGAAGCTGTGAACCAACTGCCCAGCCAATGATTCTGGATCTTCAATAAGTGTA
JMFF049I13+ ACATCTGAGAAGCTGTGAACCAACTGCCCAGCCAATGATTCTGGATCTTCAATAAGTGTA
rJMFF010B17- ACATCTGAGAAGCTGTGAACCAACTGCCCAGCCAATGATTCTGGATCTTCAATAAGTGTA
rJMSF039D23- ACATCTGAGAAGCTGTGAACCAACTGCCCAGCCAATGATTCTGGATCTTCAATAAGTGTA
                      ____________________________________________________________
consensus ACATCTGAGAAGCTGTGAACCAACTGCCCAGCCAATGATTCTGGATCTTCAATAAGTGTA
 
. : . : . : . : . : . :
JMFF010B17+ TCTACAAATGCCTTCACTACCCTAACCTCTTGACCACTTGCTCTCAAACTGTACCACGTC
JMFF049I13+ TCTACAAATGCCTTCACTACCCTAACCTCTTGACCACTTGCTCTCAAACTGTACCACGTC
rJMFF010B17- TCTACAAATGCCTTCACTACCCTAACCTCTTGACCACTTGCTCTCAAACTGTACCACGTC
rJMSF039D23- TCTACAAATGCCTTCACTACCCTAACCTCTTGACCACTTGCTCTCAAACTGTACCACGTC
                      ____________________________________________________________
consensus TCTACAAATGCCTTCACTACCCTAACCTCTTGACCACTTGCTCTCAAACTGTACCACGTC
 
. : . : . : . : . : . :
JMFF010B17+ AAGAACTTCTGCCTAAATTCCATCTCAATATGCCCACTGCATTCTAACCATCTGATTACT
JMFF049I13+ AAGAACTTCTGCCTAAATTCCATCTCAATATGCCCACTGCATTCTAACCATCTGATTACT
rJMFF010B17- AAGAACTTCTGCCTAAATTCCATCTCAATATGCCCACTGCATTCTAACCATCTGATTACT
rJMSF039D23- AAGAACTTCTGCCTAAATTCCATCTCAATATGCCCACTGCATTCTAACCATCTGATTACT
                      ____________________________________________________________
consensus AAGAACTTCTGCCTAAATTCCATCTCAATATGCCCACTGCATTCTAACCATCTGATTACT
 
. : . : . : . : . : . :
JMFF010B17+ TTCACATAGTATTCAAAATCATCCTTGTCCCCACCACATTGTTTATCAAACCTTTCGCTG
JMFF049I13+ TTCACATAGTATTCAAAATCATCCTTGTCCCCACCACATTGTTTATCAAACCTTTCGCTG
rJMFF010B17- TTCACATAGTATTCAAAATCATCCTTGTCCCCACCACATTGTTTATCAAACCTTTCGCTG
rJMSF039D23- TTCACATAGTATTCAAAATCATCCTTGTCCCCACCACATTGTTTATCAAACCTTTCGCTG
                      ____________________________________________________________
consensus TTCACATAGTATTCAAAATCATCCTTGTCCCCACCACATTGTTTATCAAACCTTTCGCTG
 
. : . : . : . : . : . :
JMFF010B17+ CTTCTCTTCTTCGACGAGCTCCCACCTCGCGGATGATCCTCCTTTCCACACCCATTCTCC
JMFF049I13+ CTTCTCTTCTTCGACGAGCTCCCACCTCGCGGATGATCCTCCTTTCCACACCCATTCTCC
rJMFF010B17- CTTCTCTTCTTCGACGAGCTCCCACCTCGCGGATGATCCTCCTTTCCACACCCATTCTCC
rJMSF039D23- CTTCTCTTCTTCGACGAGCTCCCACCTCGCGGATGATCCTCCTTTCCACACCCATTCTCC
                      ____________________________________________________________
consensus CTTCTCTTCTTCGACGAGCTCCCACCTCGCGGATGATCCTCCTTTCCACACCCATTCTCC
 
. : . : . : . : . : . :
JMFF010B17+ ACATCCTTTCCACTGCCTTGGAGGAATCTACCTTTTCGTCCAAGGAAGTCCATGCTCTCT
JMFF049I13+ ACATCCTTTCCACTGCCTTGGAGGAATCTACCTTTTCGTCCAAGGAAGTCCATGCTCTCT
rJMFF010B17- ACATCCTTTCCACTGCCTTGGAGGAATCTACCTTTTCGTCCAAGGAAGTCCATGCTCTCT
rJMSF039D23- ACATCCTTTCCACTGCCTTGGAGGAATCTACCTTTTCGTCCAAGGAAGTCCATGCTCTCT
                      ____________________________________________________________
consensus ACATCCTTTCCACTGCCTTGGAGGAATCTACCTTTTCGTCCAAGGAAGTCCATGCTCTCT
 
. : . : . : . : . : . :
JMFF010B17+ GTCTTGTAAGGCGTGATGGGCAAG-CCCCCCGCTTCCAAGTTACCTCCAGAATGCTCCAG
JMFF049I13+ GTCTTGTAAGGCGTGATGGGCAAG-CCCCCCGCTTCCAAGTTACCTCCAGAATGCTCCAG
rJMFF010B17- GTCTTGTAAGGCGTGATGGGCAAG-CCCCCCGCTTCCAAGTTACCTCCAGAATGCTCCAG
rJMSF039D23- GTCTTGTAAGGCGTGATGGGCAAGCCCCCCCGCTTCCAAGTTACCTCCAGAATGCTCCAG
                      ____________________________________________________________
consensus GTCTTGTAAGGCGTGATGGGCAAG-CCCCCCGCTTCCAAGTTACCTCCAGAATGCTCCAG
 
. : . : . : . : . : . :
JMFF010B17+ GATGGTTTCAGGAGGAGTGTTTGATCCATTGCCGGTGCTAGTCTCTTCTGCTATTTGTGC
JMFF049I13+ GATGGTTTCAGGAGGAGTGTTTGATCCATTGCCGGTGCTAGTCTCTTCTGCTATTTGTGC
rJMFF010B17- GATGGTTTCAGGAGGAGTGTTTGATCCATTGCCGGTGCTAGTCTCTTCTGCTATTTGTGC
rJMSF039D23- GATGGTTTCAGGAGGAGTGTTTGATCCATTGCCGGTGCTAGTCTCTTCTGCTATTTGTGC
                      ____________________________________________________________
consensus GATGGTTTCAGGAGGAGTGTTTGATCCATTGCCGGTGCTAGTCTCTTCTGCTATTTGTGC
 
. : . : . : . : . : . :
JMFF010B17+ ATCTGGAGAATCCTT
JMFF049I13+ ATCTGGAGAATCCTTGTTCTC
rJMFF010B17- ATCTGGAGAATCCTTGTTCTC
rJMSF039D23- ATCTGGAGAATCCTTGTTCTCAACATCTATCACATCTGTTGTATGCCGTGTGGAGCTACT
                      ____________________________________________________________
consensus ATCTGGAGAATCCTTGTTCTCAACATCTATCACATCTGTTGTATGCCGTGTGGAGCTACT
 
. : . : . : . : . : . :
rJMSF039D23- AAAATTTCGCATGCTGGGCTCCTCCCCTCCCAAACATGGCTTTACTGTCATCATCGNTGC
                      ____________________________________________________________
consensus AAAATTTCGCATGCTGGGCTCCTCCCCTCCCAAACATGGCTTTACTGTCATCATCGNTGC
 
. : . : . : . : . : . :
rJMSF039D23- TGCTGCTTTAGGGCTTTTACCCTCGCAGCATAATAGATTCGTAGAGGTGATATTATCAGT
                      ____________________________________________________________
consensus TGCTGCTTTAGGGCTTTTACCCTCGCAGCATAATAGATTCGTAGAGGTGATATTATCAGT