Previous Contig 013208:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF039D20Sequence657013208 (2)gb:AB016886_15131493e-13Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCA23.>gb:AY065304_1566891013208 (2)gb:AB016886_15131490.021Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCA23.>gb:AY065304_1566

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039D20- GGGAGAGCTACGCAG
                      ____________________________________________________________
consensus GGGAGAGCTACGCAG
 
. : . : . : . : . : . :
JMSF039D20- TGGAAAGCGAAGAGATGGCGTGGACAGGACAGCTCTCGAGAAATCTCAAGGAGATTCGGA
                      ____________________________________________________________
consensus TGGAAAGCGAAGAGATGGCGTGGACAGGACAGCTCTCGAGAAATCTCAAGGAGATTCGGA
 
. : . : . : . : . : . :
JMSF039D20- TCTTATTCTCGCCTAATTCACCTTCCAGCGCTCCTTTGAGGTATCAATAATGTCTTCGTC
                      ____________________________________________________________
consensus TCTTATTCTCGCCTAATTCACCTTCCAGCGCTCCTTTGAGGTATCAATAATGTCTTCGTC
 
. : . : . : . : . : . :
JMSF039D20- TGGTTCCCCTTTCTGTTTTTGACGGTGTAAATTGTATACTTATTTGTCTTTGAATATAGG
                      ____________________________________________________________
consensus TGGTTCCCCTTTCTGTTTTTGACGGTGTAAATTGTATACTTATTTGTCTTTGAATATAGG
 
. : . : . : . : . : . :
JMSF039D20- GCTTTTATTGAGAATAACTACAAACAAATCAAGACCCATAATCCTAAATTGCCCATCCTT
                      ____________________________________________________________
consensus GCTTTTATTGAGAATAACTACAAACAAATCAAGACCCATAATCCTAAATTGCCCATCCTT
 
. : . : . : . : . : . :
JMSF039D20- ATCCGGGAGGCCAGCTCCATTGAGCCTCAGATTTGGGCCAGATTCGGTAAATTTCTCGAT
                      ____________________________________________________________
consensus ATCCGGGAGGCCAGCTCCATTGAGCCTCAGATTTGGGCCAGATTCGGTAAATTTCTCGAT
 
. : . : . : . : . : . :
JMSF039D20- TTCTAGTTTGTATTTCGTGATAATTGGACTTCAGATGTTGCTAATTCAACCTGGCTATTG
                      ____________________________________________________________
consensus TTCTAGTTTGTATTTCGTGATAATTGGACTTCAGATGTTGCTAATTCAACCTGGCTATTG
 
. : . : . : . : . : . :
JMSF039D20- ATTTACCTATTCAAAATTTCCTGCTTTGTTCAATTTTTGTGTACTCAATGTGTTCTTTCT
                      ____________________________________________________________
consensus ATTTACCTATTCAAAATTTCCTGCTTTGTTCAATTTTTGTGTACTCAATGTGTTCTTTCT
 
. : . : . : . : . : . :
JMSF039D20- GATTGAGATTGGTTGTTCAAGGCTTTAAACAATCTGGTATTTTGGTTGGGTAGTTAATGT
                      ____________________________________________________________
consensus GATTGAGATTGGTTGTTCAAGGCTTTAAACAATCTGGTATTTTGGTTGGGTAGTTAATGT
 
. : . : . : . : . : . :
JMSF039D20- GATAATTGGGGATGGTAAAGACCCCATTTTCATACTCTGGAGTTTGGACTTGTGCTGATT
                      ____________________________________________________________
consensus GATAATTGGGGATGGTAAAGACCCCATTTTCATACTCTGGAGTTTGGACTTGTGCTGATT
 
. : . : . : . : . : . :
JMSF039D20- AAGGGTAAGCTATTGATGGCTTTACCTCTAATTTAGGCAGAAATCAATAGGTAATGAGAA
rJMSF039D20+ GCTATTGATGGC-TTACCTCTNATTTAGGCAGAAATCCATAGGTAATGAGAA
                      ____________________________________________________________
consensus AAGGGTAAGCTATTGATGGCTTTACCTCTAATTTAGGCAGAAATCCATAGGTAATGAGAA
 
. : . : . : . : . : . :
JMSF039D20- AGGAAATTTGGCTTGTTGAGCGAAACAAGCCAAATTATTAAA
rJMSF039D20+ AGGAAATTTGGCTTGTTGAGCGAANCAAGCCAAATTATTAAAAGAAAAAAACTCCGTTGA
                      ____________________________________________________________
consensus AGGAAATTTGGCTTGTTGAGCGAAACAAGCCAAATTATTAAAAGAAAAAAACTCCGTTGA
 
. : . : . : . : . : . :
rJMSF039D20+ CTTAGTCGAGTTGGGCGCTAGTTGGCTGGCTGACTAAAAGACGCCTAAGCCTGAAATCCC
                      ____________________________________________________________
consensus CTTAGTCGAGTTGGGCGCTAGTTGGCTGGCTGACTAAAAGACGCCTAAGCCTGAAATCCC
 
. : . : . : . : . : . :
rJMSF039D20+ CGGGCAACCTAGGTCGATTTTTACAACAGTGTAAGTGTGGGTGTGATTAAAAGAGAATTG
                      ____________________________________________________________
consensus CGGGCAACCTAGGTCGATTTTTACAACAGTGTAAGTGTGGGTGTGATTAAAAGAGAATTG
 
. : . : . : . : . : . :
rJMSF039D20+ TTGAAATTTTGCACAGCATAATTTGTGTTCTATAGGATATGCCTGTTTAATGGGTTTAGA
                      ____________________________________________________________
consensus TTGAAATTTTGCACAGCATAATTTGTGTTCTATAGGATATGCCTGTTTAATGGGTTTAGA
 
. : . : . : . : . : . :
rJMSF039D20+ AGGCTGGGCATATTATTTAGACCTCAGGGTTTTCCTCAGAATATAAAAAAAGCAGTTTCT
                      ____________________________________________________________
consensus AGGCTGGGCATATTATTTAGACCTCAGGGTTTTCCTCAGAATATAAAAAAAGCAGTTTCT
 
. : . : . : . : . : . :
rJMSF039D20+ TTCCAGGTTCTGGTTTGTTTCGATATGTTAAACTGTTTTAGGGGTTTTCAAGACATTTGT
                      ____________________________________________________________
consensus TTCCAGGTTCTGGTTTGTTTCGATATGTTAAACTGTTTTAGGGGTTTTCAAGACATTTGT
 
. : . : . : . : . : . :
rJMSF039D20+ GCCCCAGTTTAAGCGCCTTTTATGTTTAGCTTTCCTCATTGCTTAGTAAATATAAGAAGA
                      ____________________________________________________________
consensus GCCCCAGTTTAAGCGCCTTTTATGTTTAGCTTTCCTCATTGCTTAGTAAATATAAGAAGA
 
. : . : . : . : . : . :
rJMSF039D20+ ATGCGATAAGTTTCTCTTCTGATGCTCCAACTAATAGAATCTTTTCATTTGTAAATTAGA
                      ____________________________________________________________
consensus ATGCGATAAGTTTCTCTTCTGATGCTCCAACTAATAGAATCTTTTCATTTGTAAATTAGA
 
. : . : . : . : . : . :
rJMSF039D20+ TATGGGAGTTGAAAGGGGCTTCCAATTAGAAGGCTTCTCAGAGCAACAGATTTCGAAAGC
                      ____________________________________________________________
consensus TATGGGAGTTGAAAGGGGCTTCCAATTAGAAGGCTTCTCAGAGCAACAGATTTCGAAAGC
 
. : . : . : . : . : . :
rJMSF039D20+ ACTGGAAGACTTGGTGAAGGCTGGAGCATCCTGAAACTTGATTCCGTTGGACTGTTAAAT
                      ____________________________________________________________
consensus ACTGGAAGACTTGGTGAAGGCTGGAGCATCCTGAAACTTGATTCCGTTGGACTGTTAAAT
 
. : . : . : . : . : . :
rJMSF039D20+ GGTCTACCTTTTAATTCAGCGCTCGTATTGATGTCATAATGCTTGGCATTATACACTCAA
                      ____________________________________________________________
consensus GGTCTACCTTTTAATTCAGCGCTCGTATTGATGTCATAATGCTTGGCATTATACACTCAA
 
. : . : . : . : . : . :
rJMSF039D20+ ATAATTATACGACCATCATCTATTGCTTGTTTTGTAGTCTTAAGAATATGCAGCTTTTGA
                      ____________________________________________________________
consensus ATAATTATACGACCATCATCTATTGCTTGTTTTGTAGTCTTAAGAATATGCAGCTTTTGA
 
. : . : . : . : . : . :
rJMSF039D20+ TGTGTCTTTAGATACAAGTGCAAGGAGAGAAGTGTTTGAAGCTCTGATCTCACAATCTGC
                      ____________________________________________________________
consensus TGTGTCTTTAGATACAAGTGCAAGGAGAGAAGTGTTTGAAGCTCTGATCTCACAATCTGC
 
. : . : . : . : . : . :
rJMSF039D20+ CTTCATTAATAACCTTTGGACATTATTTTGTTTGAACTCATCTATCAAGTACCCAATTAT
                      ____________________________________________________________
consensus CTTCATTAATAACCTTTGGACATTATTTTGTTTGAACTCATCTATCAAGTACCCAATTAT