Previous Contig 013205:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF015J19Sequence470018939765013205 (2)gb:AY501342_16097357e-22Arabidopsis thaliana hypothetical protein (At2g03810) mRNA, complete cds, altern
JMSF039C22Sequence480020006846013205 (2)gb:AY501342_16097352e-23Arabidopsis thaliana hypothetical protein (At2g03810) mRNA, complete cds, altern

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039C22+ TTGATG
                      ____________________________________________________________
consensus TTGATG
 
. : . : . : . : . : . :
rJMSF039C22+ AAGCTTTTTGGATCAAAACTTGCCAAAACTGGAAAAGTAGACAATGATGCGTCCGAAACA
                      ____________________________________________________________
consensus AAGCTTTTTGGATCAAAACTTGCCAAAACTGGAAAAGTAGACAATGATGCGTCCGAAACA
 
. : . : . : . : . : . :
rJMSF015J19+ ATAAGCCGCTTCTCGAATCATCGTGTGCACAGCAGGATTGTCAGTCT
rJMSF039C22+ CAATCGTTTAGTAATAAGCCGCTTCTCGAATCATCGTGTGCACAGCAGGATTGTCAGTCT
                      ____________________________________________________________
consensus CAATCGTTTAGTAATAAGCCGCTTCTCGAATCATCGTGTGCACAGCAGGATTGTCAGTCT
 
. : . : . : . : . : . :
rJMSF015J19+ CCCGAAGAGGCAATCTTGGAAAGTCATGCTACTGTGCCAACAAATGTCGAACCAAACAAG
rJMSF039C22+ CCCGAAGAGGCAATCTTGGAAAGTCATGCTACTGTGCCAACAAATGTCGAACCAAACAAG
                      ____________________________________________________________
consensus CCCGAAGAGGCAATCTTGGAAAGTCATGCTACTGTGCCAACAAATGTCGAACCAAACAAG
 
. : . : . : . : . : . :
rJMSF015J19+ AATGACCATAGTACTTTCGACGAGAGTGCTGAAAAGATTTCCAAAAAAGCCCTTGATTCG
rJMSF039C22+ AATGACCATAGTACTTTCGACGAGAGTGCTGAAAAGATTTCCAAAAAAGCCCTTGATTCG
                      ____________________________________________________________
consensus AATGACCATAGTACTTTCGACGAGAGTGCTGAAAAGATTTCCAAAAAAGCCCTTGATTCG
 
. : . : . : . : . : . :
rJMSF015J19+ GATGCCATGCCAAATAACGAGGAAGGGATTTCGGATAAAACGTCAGCTGCACCTGCTAGC
rJMSF039C22+ GATGCCATGCCAAATAACGAGGAAGGGATTTCGGATAAAACGTCAGCTGCACCTGCTAGC
                      ____________________________________________________________
consensus GATGCCATGCCAAATAACGAGGAAGGGATTTCGGATAAAACGTCAGCTGCACCTGCTAGC
 
. : . : . : . : . : . :
rJMSF015J19+ GAAGTTCAATGCAGAAACACTGAGAAGACCGCTGAAAATTCTCGTGGAAACCCTTTAGGA
rJMSF039C22+ GAAGTTCAATGCAGAAACACTGAGAAGACCGCTGAAAATTCTCGTGGAAACCCTTTAGGA
                      ____________________________________________________________
consensus GAAGTTCAATGCAGAAACACTGAGAAGACCGCTGAAAATTCTCGTGGAAACCCTTTAGGA
 
. : . : . : . : . : . :
rJMSF015J19+ CCCGAGTTGCAAGACGTGGGTAATAGTGAGGACAAAGCCTCCGCTAATTTTTCAATTGGT
rJMSF039C22+ CCCGAGTTGCAAGACGTGGGTAATAGTGAGGACAAAGCCTCCGCTAATTTTTCAATTGGT
                      ____________________________________________________________
consensus CCCGAGTTGCAAGACGTGGGTAATAGTGAGGACAAAGCCTCCGCTAATTTTTCAATTGGT
 
. : . : . : . : . : . :
rJMSF015J19+ AGCCACGATCACGGGGAGGCTAGTTTCTCTTCGGTTGGTCCTATGTCGGGTTTAATTTCT
rJMSF039C22+ AGCCACGATCACGGGGAGGCTAGTTTCTCTTCGGTTGGTCCTATGTCGGGTTTAATTTCT
                      ____________________________________________________________
consensus AGCCACGATCACGGGGAGGCTAGTTTCTCTTCGGTTGGTCCTATGTCGGGTTTAATTTCT
 
. : . : . : . : . : . :
rJMSF015J19+ TATTCCGGACTAATCCCACATTCCGGGAACATTTCTCTTCGATCGGATAGCAGCACCACC
rJMSF039C22+ TATTCCGGACTAATCCCACATTCCGGGAACATTTCTCTTCGATCGGATAGCAGCACCACC
                      ____________________________________________________________
consensus TATTCCGGACTAATCCCACATTCCGGGAACATTTCTCTTCGATCGGATAGCAGCACCACC
 
. : . : . : . : . : . :
rJMSF015J19+ AGCGCAAGATCCTTTGCTTTCCCAATACTACAATCCGAGTGGAATAGCAGTCCGGTAAGA
rJMSF039C22+ AGCGCAAGATCCTTTGCTTTCCCAATACTACAATCCGAGTGGAATAGCAGTCCGGTAAGA
                      ____________________________________________________________
consensus AGCGCAAGATCCTTTGCTTTCCCAATACTACAATCCGAGTGGAATAGCAGTCCGGTAAGA
 
. : . : . : . : . : . :
rJMSF015J19+ ATGGCAAAAGGAGATGGGAGATACCGAAAGAACCGGGGTTGGATGCAGGGCCTTCTTTGC
rJMSF039C22+ ATGGCAAAAGGAGATGGGAGATACCGAAAGAACCGGGGTTGGATGCAGGGCCTTCTTTGC
                      ____________________________________________________________
consensus ATGGCAAAAGGAGATGGGAGATACCGAAAGAACCGGGGTTGGATGCAGGGCCTTCTTTGC
 
. : . : . : . : . : . :
rJMSF015J19+ TGTAGATTCTAAATTCTTTACTATTTCATTTAGGCTCTTAGGTAAAACGCATATACACAC
rJMSF039C22+ TGTAGATTCTAAATTCTTTACTATTTCATTTAGGCTCTTAGGTAAAACGCATATACACAC
                      ____________________________________________________________
consensus TGTAGATTCTAAATTCTTTACTATTTCATTTAGGCTCTTAGGTAAAACGCATATACACAC
 
. : . : . : . : . : . :
rJMSF015J19+ ACATCATGAAGACCAGAAGTTTTTTTAAACCGAATGCTATTTGATACATGTTGATACATA
rJMSF039C22+ ACATCATGAAGACCAGAAGTTTTTTTAAACCGAATGCTATTTGATACATGTTGATACATA
                      ____________________________________________________________
consensus ACATCATGAAGACCAGAAGTTTTTTTAAACCGAATGCTATTTGATACATGTTGATACATA
 
. : . : . : . : . : . :
rJMSF015J19+ TATATATATCTCAAGTTT-CGGGTGCACTGAAGCATATGCAGGCAAC
rJMSF039C22+ TATATATATCTCAAGTTTGCGGGTGCACTGAAGCATATGCAGGCAACCAGATGTAAAAAC
                      ____________________________________________________________
consensus TATATATATCTCAAGTTTGCGGGTGCACTGAAGCATATGCAGGCAACCAGATGTAAAAAC