Previous Contig 013204:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF039C11Sequence692013204 (2)pir|T01600|T016002e-38hypothetical protein At2g44730 [imported] - Arabidopsis thaliana>gb:AC003672_153920013204 (2)pir|T01600|T016005e-09hypothetical protein At2g44730 [imported] - Arabidopsis thaliana>gb:AC003672_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039C11- GATGTCACC
                      ____________________________________________________________
consensus GATGTCACC
 
. : . : . : . : . : . :
JMSF039C11- GTTCTCCGCCGCCCATAAATCCCCTCCTCCCCCTCTTACCTTACTACGCGCTTTCACTTT
                      ____________________________________________________________
consensus GTTCTCCGCCGCCCATAAATCCCCTCCTCCCCCTCTTACCTTACTACGCGCTTTCACTTT
 
. : . : . : . : . : . :
JMSF039C11- TTCTCACACGCGCCTTCCGCCATGGCCGCGTCGCCCACCCAATCGAACCAGGAACAGTGT
                      ____________________________________________________________
consensus TTCTCACACGCGCCTTCCGCCATGGCCGCGTCGCCCACCCAATCGAACCAGGAACAGTGT
 
. : . : . : . : . : . :
JMSF039C11- ACGACCCCGCCCGAGATCCCGTTCGCCAGCGTCACCGTCGCGTCCCACGGCGCCGGCGCT
                      ____________________________________________________________
consensus ACGACCCCGCCCGAGATCCCGTTCGCCAGCGTCACCGTCGCGTCCCACGGCGCCGGCGCT
 
. : . : . : . : . : . :
JMSF039C11- TCCTCTCGCCGCCTCCCTCCGCCGTGCTGGTCCCACGACGAGACCGTAGCGCTCATCGAC
                      ____________________________________________________________
consensus TCCTCTCGCCGCCTCCCTCCGCCGTGCTGGTCCCACGACGAGACCGTAGCGCTCATCGAC
 
. : . : . : . : . : . :
JMSF039C11- GCTTATAGGGACAAGTGGTATTCCCTCCGCCGCGGGAATCTCCGGGCGAATCACTGGCAG
                      ____________________________________________________________
consensus GCTTATAGGGACAAGTGGTATTCCCTCCGCCGCGGGAATCTCCGGGCGAATCACTGGCAG
 
. : . : . : . : . : . :
JMSF039C11- GAAGTCGCGGAGGATATCGCCGTCCGGTGCCCTGTCGATCCTCCCAAGACATCGATGCAG
                      ____________________________________________________________
consensus GAAGTCGCGGAGGATATCGCCGTCCGGTGCCCTGTCGATCCTCCCAAGACATCGATGCAG
 
. : . : . : . : . : . :
JMSF039C11- TGCCGGCACAAGATGGAGAAGCTTCGGAAACGCTACCGCGCTGAGATCCAACGCGCGGCT
                      ____________________________________________________________
consensus TGCCGGCACAAGATGGAGAAGCTTCGGAAACGCTACCGCGCTGAGATCCAACGCGCGGCT
 
. : . : . : . : . : . :
JMSF039C11- TCCTACGGCGGTGGCTCCACCCGCCGCTACTGCTCCACCTGGATCCACTTCAAACGCATG
                      ____________________________________________________________
consensus TCCTACGGCGGTGGCTCCACCCGCCGCTACTGCTCCACCTGGATCCACTTCAAACGCATG
 
. : . : . : . : . : . :
JMSF039C11- GACGCCATGGAAAGGGGCCCCGACGCGGCCTCTCCGCCACAGGATGAGGAAGAATTTGAA
rJMSF039C11+ AGGATGAGGAAGAATTTGAA
                      ____________________________________________________________
consensus GACGCCATGGAAAGGGGCCCCGACGCGGCCTCTCCGCCACAGGATGAGGAAGAATTTGAA
 
. : . : . : . : . : . :
JMSF039C11- GATGAGCCGGANGATTTCAAG-CAAAATAGCGTTAAA-CACATCGGTGATATATACAGCC
rJMSF039C11+ GATGAGCCGGAGGATTTCAAGCCAAAATAGCGTTAAANCCCATCGGTGATATATACAGCC
                      ____________________________________________________________
consensus GATGAGCCGGAGGATTTCAAGCCAAAATAGCGTTAAANCCCATCGGTGATATATACAGCC
 
. : . : . : . : . : . :
JMSF039C11- AGCACAATCTGAATTCTAATAAACGGAATAACTTTCAAGAGCCTATGAGTAATGGCGGAG
rJMSF039C11+ AGCACCATCTGAATTNTNATAAACGGAATAACTTTCAAGAGCCTATGAGTAATGGCGGAG
                      ____________________________________________________________
consensus AGCACCATCTGAATTCTAATAAACGGAATAACTTTCAAGAGCCTATGAGTAATGGCGGAG
 
. : . : . : . : . : . :
JMSF039C11- CTGGATTTCGGATCCGAATTCCCAG
rJMSF039C11+ CTGGATTTCGGATCCGAATTCCCAGTGCTAGGCCTATCCCCACTCCTCCCATGGCCAAGC
                      ____________________________________________________________
consensus CTGGATTTCGGATCCGAATTCCCAGTGCTAGGCCTATCCCCACTCCTCCCATGGCCAAGC
 
. : . : . : . : . : . :
rJMSF039C11+ CTTACAGCAAAATTGATGAAATGTTGATCCAATTCCCTAACCCTAACCCTAACCCTAATC
                      ____________________________________________________________
consensus CTTACAGCAAAATTGATGAAATGTTGATCCAATTCCCTAACCCTAACCCTAACCCTAATC
 
. : . : . : . : . : . :
rJMSF039C11+ ATGGCTCCAGTAGGTCGTATAGACGAGATGGGGTTATGAAGAAAGAGAAAGCTTCTTCTT
                      ____________________________________________________________
consensus ATGGCTCCAGTAGGTCGTATAGACGAGATGGGGTTATGAAGAAAGAGAAAGCTTCTTCTT
 
. : . : . : . : . : . :
rJMSF039C11+ TGGGGAAAAGGATCGTTGAAGAGGTGGTTGAGAAGAGAAATGGAGACCCCATAGCAGAGG
                      ____________________________________________________________
consensus TGGGGAAAAGGATCGTTGAAGAGGTGGTTGAGAAGAGAAATGGAGACCCCATAGCAGAGG
 
. : . : . : . : . : . :
rJMSF039C11+ CAGTGGCAGCAATTAAGATGCTGGGAGAAGGATTAGTGAGGGTAGAGAATATGAAAATGG
                      ____________________________________________________________
consensus CAGTGGCAGCAATTAAGATGCTGGGAGAAGGATTAGTGAGGGTAGAGAATATGAAAATGG
 
. : . : . : . : . : . :
rJMSF039C11+ ATGTCGCAAGGGAGTTAGAACAGATGAAGATGGAAATGGAGATGAAGAAGACTGAAATGA
                      ____________________________________________________________
consensus ATGTCGCAAGGGAGTTAGAACAGATGAAGATGGAAATGGAGATGAAGAAGACTGAAATGA
 
. : . : . : . : . : . :
rJMSF039C11+ TTCTTGAATCCCAACAAAAGATCGTCGAAGCTTTTGCCATGTCATTCTCTGAAAAGAACC
                      ____________________________________________________________
consensus TTCTTGAATCCCAACAAAAGATCGTCGAAGCTTTTGCCATGTCATTCTCTGAAAAGAACC
 
. : . : . : . : . : . :
rJMSF039C11+ CTAAGAAGGCCAGGAGAATGCCAACCCCTGAATGTTAGAGGGGCTGTGACTGATCTCCAG
                      ____________________________________________________________
consensus CTAAGAAGGCCAGGAGAATGCCAACCCCTGAATGTTAGAGGGGCTGTGACTGATCTCCAG
 
. : . : . : . : . : . :
rJMSF039C11+ TGGTAAATTTCCCTCTTTCAAACTTTGGAATGAATTATTGGCTTGGGATGGATATATGAG
                      ____________________________________________________________
consensus TGGTAAATTTCCCTCTTTCAAACTTTGGAATGAATTATTGGCTTGGGATGGATATATGAG
 
. : . : . : . : . : . :
rJMSF039C11+ TGCTGTTCAACTTTCGAATTCTGGCAAAACCGCAAACAATTTGAACATTTAGGTTCTGAA
                      ____________________________________________________________
consensus TGCTGTTCAACTTTCGAATTCTGGCAAAACCGCAAACAATTTGAACATTTAGGTTCTGAA
 
. : . : . : . : . : . :
rJMSF039C11+ GTTGCTTCTCATCTTGATGACACTGCATTTCTTAAGCCTTGCCTTTTGCTTTTTCAGTAG
                      ____________________________________________________________
consensus GTTGCTTCTCATCTTGATGACACTGCATTTCTTAAGCCTTGCCTTTTGCTTTTTCAGTAG
 
. : . : . : . : . : . :
rJMSF039C11+ TATAGGAACTCAGCACTTTAGTAGTGTATCTTGTTTATGAACTGATATAGGTTTTCTCTA
                      ____________________________________________________________
consensus TATAGGAACTCAGCACTTTAGTAGTGTATCTTGTTTATGAACTGATATAGGTTTTCTCTA
 
. : . : . : . : . : . :
rJMSF039C11+ GCAATTGCAGTATTTATCAATCAATTTGTTTAGAACGGAACTTTTTATTTTGCTGGAGCT
                      ____________________________________________________________
consensus GCAATTGCAGTATTTATCAATCAATTTGTTTAGAACGGAACTTTTTATTTTGCTGGAGCT