Previous Contig 013202:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001E22Sequence344004308 (3)gb:BT002403_16360061e-28Arabidopsis thaliana Unknown protein (At1g71440) mRNA, complete cds.>gb:BT008888177013202 (3)gb:BT002403_16360065e-06Arabidopsis thaliana Unknown protein (At1g71440) mRNA, complete cds.>gb:BT008888
JMSF039B24Sequence693004308 (3)gb:BT002403_16360064e-73Arabidopsis thaliana Unknown protein (At1g71440) mRNA, complete cds.>gb:BT008888825013202 (3)gb:AY085930_15709933e-66Arabidopsis thaliana clone 19761 mRNA, complete sequence.>gb:AF486853_1804189 Ar
JMSF049M22Sequence369004308 (3)gb:BT002403_16360061e-38Arabidopsis thaliana Unknown protein (At1g71440) mRNA, complete cds.>gb:BT008888178013202 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039B24+ TGGTAACAACATCATTAAAGATGTGGAATCTGTTGATTTCGCTGAATT
                      ____________________________________________________________
consensus TGGTAACAACATCATTAAAGATGTGGAATCTGTTGATTTCGCTGAATT
 
. : . : . : . : . : . :
rJMSF039B24+ ATTTTCCTAATTTGTTGGAAGTAAGACTTTCTGAGAATCCAGTGACAGATCCAGTAAAAA
                      ____________________________________________________________
consensus ATTTTCCTAATTTGTTGGAAGTAAGACTTTCTGAGAATCCAGTGACAGATCCAGTAAAAA
 
. : . : . : . : . : . :
rJMSF039B24+ GTGGCCTATCTCGATTTGTTTTGGTGGCACGCCTAGCAGGAGTAAAAATATTAAATGGAA
                      ____________________________________________________________
consensus GTGGCCTATCTCGATTTGTTTTGGTGGCACGCCTAGCAGGAGTAAAAATATTAAATGGAA
 
. : . : . : . : . : . :
rJMSF039B24+ GTGAGATTAGTCCTAGAGAGCGGAAGGAATCTGAAATTCGGTATGTCCGATTAGTCATGT
                      ____________________________________________________________
consensus GTGAGATTAGTCCTAGAGAGCGGAAGGAATCTGAAATTCGGTATGTCCGATTAGTCATGT
 
. : . : . : . : . : . :
rJMSF039B24+ CTAAATGTCATGAATATCCACAAGAAATCGACCGACTTCACCCGAGATTTGCTGAGCTAA
                      ____________________________________________________________
consensus CTAAATGTCATGAATATCCACAAGAAATCGACCGACTTCACCCGAGATTTGCTGAGCTAA
 
. : . : . : . : . : . :
rJMSF039B24+ AAAGACACCATGGAATTGATGATGAAAAACCAGAGAGTGGAACAACCGGACCCCAGAAAA
                      ____________________________________________________________
consensus AAAGACACCATGGAATTGATGATGAAAAACCAGAGAGTGGAACAACCGGACCCCAGAAAA
 
. : . : . : . : . : . :
rJMSF039B24+ TGGCTGCAGGACTTATATCAATTACCATGAAGTGTATTGGAGCATCAATCGGTGAAAAGC
                      ____________________________________________________________
consensus TGGCTGCAGGACTTATATCAATTACCATGAAGTGTATTGGAGCATCAATCGGTGAAAAGC
 
. : . : . : . : . : . :
rJMSF039B24+ CTCCATTGACCAAAAAGTTGCCTGTGACAATCACGGTTGGCAAGCTGAAGAACCTTTGCG
                      ____________________________________________________________
consensus CTCCATTGACCAAAAAGTTGCCTGTGACAATCACGGTTGGCAAGCTGAAGAACCTTTGCG
 
. : . : . : . : . : . :
rJMSF001E22+ TTTCTTCAGGAAGCGGGCGCCC
rJMSF039B24+ AGAGTTTCTTCAACATAAGATCTATCAAGCCTAAATTATTTCTTCAGGAAGCGGGCGCCC
                      ____________________________________________________________
consensus AGAGTTTCTTCAACATAAGATCTATCAAGCCTAAATTATTTCTTCAGGAAGCGGGCGCCC
 
. : . : . : . : . : . :
rJMSF001E22+ CATTTCCAACGNTGCTCGAGGATGATATGGCAACTNTGCTGGATGCTGGAGTGGGTAATG
rJMSF049M22+ TGCTGGAGTGGGTAATG
rJMSF039B24+ CATTTCCAACGCTGCTCGAGGATGATATGGCAACTTTGCTGGATGCTGGAGTGGGTAATG
                      ____________________________________________________________
consensus CATTTCCAACGCTGCTCGAGGATGATATGGCAACTTTGCTGGATGCTGGAGTGGGTAATG
 
. : . : . : . : . : . :
rJMSF001E22+ AGTCAACCATTCTTGTGGATGAAGAGTAATATAATGCTGTCCTCACAATCCAGAAAAATC
rJMSF049M22+ AGTCAACCATTCTTGTGGATNAAGAGTAATATNATGCTGTCCTCACAA-CCAGAAAAATC
rJMSF039B24+ AGTCAACCATTCTTGTGGATGAAGAGTAATATAATGCTGTCCTCACAA-CCAGAAAAATC
                      ____________________________________________________________
consensus AGTCAACCATTCTTGTGGATGAAGAGTAATATAATGCTGTCCTCACAA-CCAGAAAAATC
 
. : . : . : . : . : . :
rJMSF001E22+ TTAATTTTTTTTTCCTATCGGATA-ACATTATGATG
rJMSF049M22+ NTAATTTTTTTTTCCTATCGGATATACATTATGATGTGGAACTGGATTTGTGTTTGGAAA
rJMSF039B24+ TTAATTTTTTTTTCCTATCGGATA-ACATTATGATGTGGAACTGGATTTGTGTTTGGAAA
                      ____________________________________________________________
consensus TTAATTTTTTTTTCCTATCGGATA-ACATTATGATGTGGAACTGGATTTGTGTTTGGAAA
 
. : . : . : . : . : . :
rJMSF049M22+ ATGCAGTTNTGTCGTTCAAGAATTNGACCTACATGCATCATA
rJMSF039B24+ ATGCAGTTTTGTCGTTCAAGAATTTGACCT-CATGCATCATACAAGTATGTGGTTGTTGT
                      ____________________________________________________________
consensus ATGCAGTTTTGTCGTTCAAGAATTTGACCTACATGCATCATACAAGTATGTGGTTGTTGT
 
. : . : . : . : . : . :
rJMSF039B24+ TTGATGAACTTATGCAATTTTATTACACAAATTATATCCATTATGGATATATATATATAT
                      ____________________________________________________________
consensus TTGATGAACTTATGCAATTTTATTACACAAATTATATCCATTATGGATATATATATATAT