Previous Contig 013199:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF039A14Sequence642007261 (2)gb:BT010886_16408322e-30Arabidopsis thaliana At5g18550 gene, complete cds.756013199 (3)
JMSF039M03Sequence676007261 (2)gb:BT010886_16408327e-46Arabidopsis thaliana At5g18550 gene, complete cds.840013199 (3)
JMSF048J01Sequence675007741 (3)gb:BT010886_16408328e-51Arabidopsis thaliana At5g18550 gene, complete cds.723013199 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039M03+ ATCTTCAGACTTGAGGCCGGAACTTATTTCGGGGATCC
                      ____________________________________________________________
consensus ATCTTCAGACTTGAGGCCGGAACTTATTTCGGGGATCC
 
. : . : . : . : . : . :
rJMSF039M03+ GGGAGCGAGGCATTCTCTACCCAGACGTCTTCCATGAGCACTTCAAGTGGTGCGGTTGGT
                      ____________________________________________________________
consensus GGGAGCGAGGCATTCTCTACCCAGACGTCTTCCATGAGCACTTCAAGTGGTGCGGTTGGT
 
. : . : . : . : . : . :
rJMSF039M03+ TCGATATTTTCGAACACTGGTCCTGCTTCCCACTCGGGCGTTCAACCGTCCGGGCAGAGT
rJMSF048J01+ CCGGGCAGAGT
rJMSF039A14+ GCTTCCCACTCGGGCGTTCAACCGTCCGGGCAGAGT
                      ____________________________________________________________
consensus TCGATATTTTCGAACACTGGTCCTGCTTCCCACTCGGGCGTTCAACCGTCCGGGCAGAGT
 
. : . : . : . : . : . :
rJMSF039M03+ TCGAGTGGAAGTGGTAGCACAGGCCACGGAGGTGAGGTTCACTCATCGAGCTAAAACGAT
rJMSF048J01+ TCGAGTGGAAGTGGTAGCACAGGCCACGGAGGTGAGGTTCACTCATCGAGCTAAAACGAT
rJMSF039A14+ TCGAGTGGAAGTGGTAGCACAGGCCACGGAGGTGAGGTTCACTCATCGAGCTAAAACGAT
                      ____________________________________________________________
consensus TCGAGTGGAAGTGGTAGCACAGGCCACGGAGGTGAGGTTCACTCATCGAGCTAAAACGAT
 
. : . : . : . : . : . :
rJMSF039M03+ TGAGTGATTTTCGTTTTTTCGTTGCTCAATGACCATGAAGTAGCGTTAAATTTTTGGTGC
rJMSF048J01+ TGAGTGATTTTCGTTTTTTCGTTGCTCAATGACCATGAAGTAGCGTTAAATTTTTGGTGC
rJMSF039A14+ TGAGTGATTTTCGTTTTTTCGTTGCTCAATGACCATGAAGTAGCGTTAAATTTTTGGTGC
                      ____________________________________________________________
consensus TGAGTGATTTTCGTTTTTTCGTTGCTCAATGACCATGAAGTAGCGTTAAATTTTTGGTGC
 
. : . : . : . : . : . :
rJMSF039M03+ TAGTCAATCATTTCTAGGAAGCTTCTTCTCTTGGTCATCATAGTTCACACGTAGTAGCTC
rJMSF048J01+ TAGTCAATCATTTCTAGGAAGCTTCTTCTCTTGGTCATCATAGTTCACACGTAGTAGCTC
rJMSF039A14+ TAGTCAATCATTTCTAGGAAGCTTCTTCTCTTGGTCATCATAGTTCACACGTAGTAGCTC
                      ____________________________________________________________
consensus TAGTCAATCATTTCTAGGAAGCTTCTTCTCTTGGTCATCATAGTTCACACGTAGTAGCTC
 
. : . : . : . : . : . :
rJMSF039M03+ TGTTCTTCATCTGTGTGTTCATAAAATCATTATATCTGGCAAATTTTCCGTATCGAATAA
rJMSF048J01+ TGTTCTTCATCTGTGTGTTCATAAAATCATTATATCTGGCAAATTTTCCATATCGAATAA
rJMSF039A14+ TGTTCTTCATCTGTGTGTTCATAAAATCATTATATCTGGCAAATTTTCCATATCGAATAA
                      ____________________________________________________________
consensus TGTTCTTCATCTGTGTGTTCATAAAATCATTATATCTGGCAAATTTTCCATATCGAATAA
 
. : . : . : . : . : . :
rJMSF039M03+ GTGGAAGTTCTAGAAGATCCATCCATCAACCCGCAATATAGTCCTCCCTCTCTGTAGCTA
rJMSF048J01+ GTGGAAGTTCTAGAAGATCCATCCATCAACCCGCAATATAGTCCTCCCTCTCTGTAGCTA
rJMSF039A14+ GTGGAAGTTCTAGAAGATCCATCCATCAACCCGCAATATAGTCCTCCCTCTCTGTAGCTA
                      ____________________________________________________________
consensus GTGGAAGTTCTAGAAGATCCATCCATCAACCCGCAATATAGTCCTCCCTCTCTGTAGCTA
 
. : . : . : . : . : . :
rJMSF039M03+ GCTTTTGAATAACAACACCCGCCTTCCATTTAGGAGAATTTGCTTCCATTCCAAAATTTT
rJMSF048J01+ GCTTTTGAATAACAACACCCGCCTTCCATTTAGGAGAATTTGCTTCCATTCCAAAATTTT
rJMSF039A14+ GCTTTTGAATAACAACACCCGCCTTCCATTTAGGAGAATTTGCTTCCATTCCAAAATTTT
                      ____________________________________________________________
consensus GCTTTTGAATAACAACACCCGCCTTCCATTTAGGAGAATTTGCTTCCATTCCAAAATTTT
 
. : . : . : . : . : . :
rJMSF039M03+ GGACCTTGTTGTGCCTTCCTGCCTATTTATGTTGTAGTCTTTGTTCGGAACAAGAAACAA
rJMSF048J01+ GGACCTTGTTGTGCCTTCCTGCCTATTTATGTTGTAGTCTTTGTTCGGAACAAGAAACAA
rJMSF039A14+ GGACCTTGTTGTGCCTTCCTGCCTATTTATGTTGTAGTCTTTGTTCGGAACAAGAAACAA
                      ____________________________________________________________
consensus GGACCTTGTTGTGCCTTCCTGCCTATTTATGTTGTAGTCTTTGTTCGGAACAAGAAACAA
 
. : . : . : . : . : . :
rJMSF039M03+ ACGATTGTTCCTACACCATTGCCCTTTTGAAAATTGACTCTCTTCCCGTCTATCTAGTCC
rJMSF048J01+ ACGATTGTTCCTACACCATTGCCCTTTTGAAAATTGACTCTCTTCCCGTCTATCTAGTCC
rJMSF039A14+ ACGATTGTTCCTACACCATTGCCCTTTTGAAAATTGACTCTCTTCCCGTCTATCTAGTCC
                      ____________________________________________________________
consensus ACGATTGTTCCTACACCATTGCCCTTTTGAAAATTGACTCTCTTCCCGTCTATCTAGTCC
 
. : . : . : . : . : . :
rJMSF039M03+ TTTTTGAAATCGGGACTCGGGAGCAAGCTTCCATCTTGACATTCTACTTAATTTTAAAGT
rJMSF048J01+ TTTTTGAAATCGGGACTCGGGAGCAAGCTTCCATCTTGACATTCTACTTAATTTTAAAGT
rJMSF039A14+ TTTTTGAAATCGGGACTCGGGAGCAAGCTTCCATCTTGACATTCTACTTAATTTTAAAGT
                      ____________________________________________________________
consensus TTTTTGAAATCGGGACTCGGGAGCAAGCTTCCATCTTGACATTCTACTTAATTTTAAAGT
 
. : . : . : . : . : . :
rJMSF039M03+ CTCCTTGTTCGTTCCCCCTTTTTGGCTGGGGCATTGTTGTGGCAGATGAAAACTGCGAGG
rJMSF048J01+ CTCCTTGTTCGTTCCCCCTTTTTGGCTGGGGCATTGTTGTGGCAGATGAAAACTGCGAGG
rJMSF039A14+ CTCCTTGTTCGTTCCCCCTTTTTGGCTGGGGCATTGTTGTGGCAGATGAAAACTGCGAGG
                      ____________________________________________________________
consensus CTCCTTGTTCGTTCCCCCTTTTTGGCTGGGGCATTGTTGTGGCAGATGAAAACTGCGAGG
 
. : . : . : . : . : . :
rJMSF039M03+ CAATTAAATGCCGCCGTTTATGGATAAGATCCATACTTATGTTGTGTATGTATGTGAATT
rJMSF048J01+ CAATTAAATGCCGCCGTTTATGGATAAGATCCATACTTATGTTGTGTATGTATGTGAATT
rJMSF039A14+ CAATTAAATGCCGCCGTTTATGGATAAGATCCATACTTATGTTGTGTATGTATGTGAATT
                      ____________________________________________________________
consensus CAATTAAATGCCGCCGTTTATGGATAAGATCCATACTTATGTTGTGTATGTATGTGAATT
 
. : . : . : . : . : . :
rJMSF039M03+ TCTTTGGCAACTTGATAAATGT
rJMSF048J01+ TCTTTGGCAACTTGATAAATGTTATCACGGTATACAACAGA-TTATCGAAAAC
rJMSF039A14+ TCTTTGGCAACTTGATAAATGTTATCACGGTATACAACAGATTTATCGAAAACCCTGAAC
                      ____________________________________________________________
consensus TCTTTGGCAACTTGATAAATGTTATCACGGTATACAACAGATTTATCGAAAACCCTGAAC