Previous Contig 013194:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF038O24Sequence644013194 (2)gb:BT010676_16406225e-22Arabidopsis thaliana At4g33690 mRNA, complete cds.>gb:BT010975_1640921 Arabidops846013194 (2)gb:AP005441_18518049e-19Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038O24- AGGGGTCGATACC
                      ____________________________________________________________
consensus AGGGGTCGATACC
 
. : . : . : . : . : . :
JMSF038O24- TTTCCTTTCTTTCGTCGTGAACTCTGAACCCCAACGCGTCTATCTATCTAGGGTTTTCTA
                      ____________________________________________________________
consensus TTTCCTTTCTTTCGTCGTGAACTCTGAACCCCAACGCGTCTATCTATCTAGGGTTTTCTA
 
. : . : . : . : . : . :
JMSF038O24- AGATTCCAAAGTGTGATAATTTTATGTAATTTTCCCAAAATTGAATTGATTCTAGCAGAA
                      ____________________________________________________________
consensus AGATTCCAAAGTGTGATAATTTTATGTAATTTTCCCAAAATTGAATTGATTCTAGCAGAA
 
. : . : . : . : . : . :
JMSF038O24- ATTTCACAATCCAAAACACGACCTACTAAGAATCTTAGCCTGTAGCGACAGAGATCAAAA
                      ____________________________________________________________
consensus ATTTCACAATCCAAAACACGACCTACTAAGAATCTTAGCCTGTAGCGACAGAGATCAAAA
 
. : . : . : . : . : . :
JMSF038O24- CCCTAGCAGCCGGGAGACCTCCGGGCTCTAGCCGCCTGCGAAGCATCACCGATCACCTGC
                      ____________________________________________________________
consensus CCCTAGCAGCCGGGAGACCTCCGGGCTCTAGCCGCCTGCGAAGCATCACCGATCACCTGC
 
. : . : . : . : . : . :
JMSF038O24- GCCCCTCCAACAGCCGGAAAAACCATCTCCGGGCGCTTGGCAGAATCGGCTCCTTCGCGA
                      ____________________________________________________________
consensus GCCCCTCCAACAGCCGGAAAAACCATCTCCGGGCGCTTGGCAGAATCGGCTCCTTCGCGA
 
. : . : . : . : . : . :
JMSF038O24- ACCCAGAGGACATTAGCTATGGATTTGGCAACTGAAAACAGAATTGCTGCGATTCTCTTA
                      ____________________________________________________________
consensus ACCCAGAGGACATTAGCTATGGATTTGGCAACTGAAAACAGAATTGCTGCGATTCTCTTA
 
. : . : . : . : . : . :
JMSF038O24- AAAGAAGCTGCAGAATTACGGCGGCAAGCTGAGAAAGATGGTGCACTTGCTTATCTTCAT
                      ____________________________________________________________
consensus AAAGAAGCTGCAGAATTACGGCGGCAAGCTGAGAAAGATGGTGCACTTGCTTATCTTCAT
 
. : . : . : . : . : . :
JMSF038O24- AGACCTACAGTTAGGGGGCGACCAAATTCAAGATTTCTAACGGCAACTGTTCTCGGCGTA
rJMSF038O24+ GGCGTA
                      ____________________________________________________________
consensus AGACCTACAGTTAGGGGGCGACCAAATTCAAGATTTCTAACGGCAACTGTTCTCGGCGTA
 
. : . : . : . : . : . :
JMSF038O24- CAACAAGCTAATCGAGCTGTTGAAGTAAATGAGATGTGGCGGCTTAGACAGAAAGAGCTG
rJMSF038O24+ CAACCAGCTAATCGAGCTGTTGAAGTAANTGAGATGTGGCGGCTTAGACAGAAAGAGCTG
                      ____________________________________________________________
consensus CAACCAGCTAATCGAGCTGTTGAAGTAAATGAGATGTGGCGGCTTAGACAGAAAGAGCTG
 
. : . : . : . : . : . :
JMSF038O24- GAGGTTGATAATAGGAACAAACGAAGATTGGAAAATGAGTGTAGGAACAAACAAATATTG
rJMSF038O24+ GAGGTTGATAATAGGAACAAACGAAGATTGGAAAATGAGTGTAGGAACAAACAAATATTG
                      ____________________________________________________________
consensus GAGGTTGATAATAGGAACAAACGAAGATTGGAAAATGAGTGTAGGAACAAACAAATATTG
 
. : . : . : . : . : . :
JMSF038O24- GACAATGAGAATAAGAACAAACGTAGATCAG
rJMSF038O24+ GACAATGAGAATAAGAACAAACGTAGATCAGAAAATGAGAATAGCAGCACAAGGAGTCAT
                      ____________________________________________________________
consensus GACAATGAGAATAAGAACAAACGTAGATCAGAAAATGAGAATAGCAGCACAAGGAGTCAT
 
. : . : . : . : . : . :
rJMSF038O24+ AAGGATGTTATGGAATCTAGGATTAAGGCTAAGAGACACAGTGATGTTGGTTCTACTTCA
                      ____________________________________________________________
consensus AAGGATGTTATGGAATCTAGGATTAAGGCTAAGAGACACAGTGATGTTGGTTCTACTTCA
 
. : . : . : . : . : . :
rJMSF038O24+ AGTGCTTCATGCCCATCAAAGAAGAGAGACATTGAAGATTACTATTCAAGGGAGGATGGC
                      ____________________________________________________________
consensus AGTGCTTCATGCCCATCAAAGAAGAGAGACATTGAAGATTACTATTCAAGGGAGGATGGC
 
. : . : . : . : . : . :
rJMSF038O24+ TTGAGGGATGCTGAAGTTGAAGAATTTTTGCATTCAAGGGCTAAGAGAGGAAGGGGCACA
                      ____________________________________________________________
consensus TTGAGGGATGCTGAAGTTGAAGAATTTTTGCATTCAAGGGCTAAGAGAGGAAGGGGCACA
 
. : . : . : . : . : . :
rJMSF038O24+ GTCGGGTCACGAATGGATGAAACTGGTCCTTACCCTTGTTTAGATCCTGAAGAAAAGCAG
                      ____________________________________________________________
consensus GTCGGGTCACGAATGGATGAAACTGGTCCTTACCCTTGTTTAGATCCTGAAGAAAAGCAG
 
. : . : . : . : . : . :
rJMSF038O24+ TTGTCAGGTCCTGATATGGGGCCGAGAGTAGAATTCAAAGATCATGCCATCATCGGGCCA
                      ____________________________________________________________
consensus TTGTCAGGTCCTGATATGGGGCCGAGAGTAGAATTCAAAGATCATGCCATCATCGGGCCA
 
. : . : . : . : . : . :
rJMSF038O24+ GAGAATCCCCGTTGGTTGAATTCCTCGGAGTCTTCAGAAGATGAAATAGTTTCAGGTGAT
                      ____________________________________________________________
consensus GAGAATCCCCGTTGGTTGAATTCCTCGGAGTCTTCAGAAGATGAAATAGTTTCAGGTGAT
 
. : . : . : . : . : . :
rJMSF038O24+ GATAAGATAAAAGTATCAAAAAAATATCATAGTAGGAAAGACAAATCTAAGAGCAAATCA
                      ____________________________________________________________
consensus GATAAGATAAAAGTATCAAAAAAATATCATAGTAGGAAAGACAAATCTAAGAGCAAATCA
 
. : . : . : . : . : . :
rJMSF038O24+ AGAGAGAAGGATAAAAAGAGGAGGGATTCGAAAAGACACAAGTCCCACAAGTAGGATAAT
                      ____________________________________________________________
consensus AGAGAGAAGGATAAAAAGAGGAGGGATTCGAAAAGACACAAGTCCCACAAGTAGGATAAT
 
. : . : . : . : . : . :
rJMSF038O24+ CTGAAGAAGTTTATTATGTACTCTTCAGCTGATGATCATTCATTTCCGTGTACTTTCCAG
                      ____________________________________________________________
consensus CTGAAGAAGTTTATTATGTACTCTTCAGCTGATGATCATTCATTTCCGTGTACTTTCCAG
 
. : . : . : . : . : . :
rJMSF038O24+ CACTGGATGAAGAATTTCCAATTGCCTTGTACTATTGTGAGTTAGTATTGGGGTCTGTTG
                      ____________________________________________________________
consensus CACTGGATGAAGAATTTCCAATTGCCTTGTACTATTGTGAGTTAGTATTGGGGTCTGTTG
 
. : . : . : . : . : . :
rJMSF038O24+ TCTACATACGGTGATTTAGTGTTTCCCACCCCTCTTCCCCTTGCAACTCTCTCTATTATT
                      ____________________________________________________________
consensus TCTACATACGGTGATTTAGTGTTTCCCACCCCTCTTCCCCTTGCAACTCTCTCTATTATT