Previous Contig 013191:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF038O15Sequence680013191 (4)gb:AY039525_15602391e-52Arabidopsis thaliana AT3g57280/F28O9_130 mRNA, complete cds.>gb:AY052733_1562893848013191 (4)gb:AY039525_15602396e-54Arabidopsis thaliana AT3g57280/F28O9_130 mRNA, complete cds.>gb:AY052733_1562893
JMSF049F18Sequence706013191 (4)gb:AY039525_15602393e-57Arabidopsis thaliana AT3g57280/F28O9_130 mRNA, complete cds.>gb:AY052733_1562893750013191 (4)gb:AY039525_15602396e-50Arabidopsis thaliana AT3g57280/F28O9_130 mRNA, complete cds.>gb:AY052733_1562893

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038O15- GGTGGATTGATCTTCCTCCCAGAAGGATCGGCAGCCACCGAAGACC
JMSF049F18- GATTGATCTTCCTCCCAGAAGGATCGGCAGCCACCGAAGACC
                      ____________________________________________________________
consensus GGTGGATTGATCTTCCTCCCAGAAGGATCGGCAGCCACCGAAGACC
 
. : . : . : . : . : . :
JMSF038O15- TTAGAGAGCAGTAGCAATGTCGTCGTCGGCGATTTCTCAGCTGTCTTGCTTCTCTTCCGT
JMSF049F18- TTAGAGAGCAGTAGCAATGTCGTCGTCGGCGATTTCTCAGCTGTCTTGCTTCTCTTCCGT
                      ____________________________________________________________
consensus TTAGAGAGCAGTAGCAATGTCGTCGTCGGCGATTTCTCAGCTGTCTTGCTTCTCTTCCGT
 
. : . : . : . : . : . :
JMSF038O15- AACTCGCCGTGCACAGCTCCGCACCCGATTCTCTCCTTCCCCTGCTCTTCGCCCCAAGGT
JMSF049F18- AACTCGCCGTGCACAGCTCCGCACCCGATTCTCTCCTTCCCCTGCTCTTCGCCCCAAGGT
rJMSF038O15+ CCCAAGGT
                      ____________________________________________________________
consensus AACTCGCCGTGCACAGCTCCGCACCCGATTCTCTCCTTCCCCTGCTCTTCGCCCCAAGGT
 
. : . : . : . : . : . :
JMSF038O15- TTTTAAATGTTTGAGTAATGATGGGCGAGGCACAGATGTATCCAGTGTAGAGGGTAAGTC
JMSF049F18- TTTTAAATGTTTGAGTAATGATGGGCGAGGCACAGATGTATCCAGTGTAGAGGGTAAGTC
rJMSF038O15+ TTTTAAATGTTTGAGTAATGATGGGCGAGGCACAGATGTATCCAGTGTAGAGGGTAAGTC
                      ____________________________________________________________
consensus TTTTAAATGTTTGAGTAATGATGGGCGAGGCACAGATGTATCCAGTGTAGAGGGTAAGTC
 
. : . : . : . : . : . :
JMSF038O15- TGCTCTAAGCTATACTACAGATCCATTAAAACCACAGGATGGAAGACCAGAAAACCCGCT
JMSF049F18- TGCTCTAAGCTATACTACAGATCCATTAAAACCACAGGATGGAAGACCAGAAAACCCGCT
rJMSF049F18+ ACCACAGGATGGAAGACCAGAAAACCCGCT
rJMSF038O15+ TGCTCTAAGCTATACTACAGATCCATTAAAACCACAGGATGGAAGACCAGAAAACCCGCT
                      ____________________________________________________________
consensus TGCTCTAAGCTATACTACAGATCCATTAAAACCACAGGATGGAAGACCAGAAAACCCGCT
 
. : . : . : . : . : . :
JMSF038O15- TTCAGCTTTAGAAGAATCTGCAACTGGAAAAAATTCAAGTGATCCATTACAAGGAACAAG
JMSF049F18- TTCAGCTTTAGAAGAATCTGCAACTGGAAAAAATTCAAGTGATCCATTACAAGGAACAAG
rJMSF049F18+ TTCAGCTTTAGAAGAATCTGCAACTGGAAAAAATTCAAGTGATCCATTACAAGGAACAAG
rJMSF038O15+ TTCAGCTTTAGAAGAATCTGCAACTGGAAAAAATTCAAGTGATCCATTACAAGGAACAAG
                      ____________________________________________________________
consensus TTCAGCTTTAGAAGAATCTGCAACTGGAAAAAATTCAAGTGATCCATTACAAGGAACAAG
 
. : . : . : . : . : . :
JMSF038O15- TGACCTGGCAGGAGAAGATATCACCTCTCAACCTAAAAGGGCTGCAAAAATTCATGATTT
JMSF049F18- TGACCTGGCAGGAGAAGATATCACCTCTCAACCTAAAAGGGCTGCAAAAATTCATGATTT
rJMSF049F18+ TGACCTGGCAGGAGAAGATATCACCTCTCAACCTAAAAGGGCTGCAAAAATTCATGATTT
rJMSF038O15+ TGACCTGGCAGGAGAAGATATCACCTCTCAACCTAAAAGGGCTGCAAAAATTCATGATTT
                      ____________________________________________________________
consensus TGACCTGGCAGGAGAAGATATCACCTCTCAACCTAAAAGGGCTGCAAAAATTCATGATTT
 
. : . : . : . : . : . :
JMSF038O15- CTGTTTTGGAATTCCCTTTGGCACTTTTGTTCTAAGTGGGGGACTGCTTGGTTTTATTTT
JMSF049F18- CTGTTTTGGAATTCCCTTTGGCACTTTTGTTCTAAGTGGGGGACTGCTTGGTTTTATTTT
rJMSF049F18+ CTGTTTTGGAATTCCCTTTGGCACTTTTGTTCTAAGTGGGGGACTGCTTGGTTTTATTTT
rJMSF038O15+ CTGTTTTGGAATTCCCTTTGGCACTTTTGTTCTAAGTGGGGGACTGCTTGGTTTTATTTT
                      ____________________________________________________________
consensus CTGTTTTGGAATTCCCTTTGGCACTTTTGTTCTAAGTGGGGGACTGCTTGGTTTTATTTT
 
. : . : . : . : . : . :
JMSF038O15- CTCAAGAAATATTACTACTCTAGGTAACGGTGTGCTATTTGGAGGTGCTTTGCTGGCTCT
JMSF049F18- CTCAAGAAATATTACTACTCTAGGTAACGGTGTGCTATTTGGAGGTGCTTTGCTGGCTCT
rJMSF049F18+ CTCAAGAAATATTACTACTCTAGGTAACGGTGTGCTATTTGGAGGTGCTTTGCTGGCTCT
rJMSF038O15+ CTCAAGAAATATTACTACTCTAGGTAACGGTGTGCTATTTGGAGGTGCTTTGCTGGCTCT
                      ____________________________________________________________
consensus CTCAAGAAATATTACTACTCTAGGTAACGGTGTGCTATTTGGAGGTGCTTTGCTGGCTCT
 
. : . : . : . : . : . :
JMSF038O15- CAGCACTGTTAGCTTGAAGGTGTGGAGACAAGGAAAATCTAGCTTGCCATTTATACTAGG
JMSF049F18- CAGCACTGTTAGCTTGAAGGTGTGGAGACAAGGAAAATCTAGCTTGCCATTTATACTAGG
rJMSF049F18+ CAGCACTGTTAGCTTGAAGGTGTGGAGACAAGGAAAATCTAGCTTGCCATTTATACTAGG
rJMSF038O15+ CAGCACTGTTAGCTTGAAGGTGTGGAGACAAGGAAAATCTAGCTTGCCATTTATACTAGG
                      ____________________________________________________________
consensus CAGCACTGTTAGCTTGAAGGTGTGGAGACAAGGAAAATCTAGCTTGCCATTTATACTAGG
 
. : . : . : . : . : . :
JMSF038O15- CCAAGCAGTACTCGCTGGCTTTCTTCTATGGAAGAATGTGCAGACCTATTCATTGACTAA
JMSF049F18- CCAAGCAGTACTCGCTGGCTTTCTTCTATGGAAGAATGTGCAGACCTATTCATTGACTAA
rJMSF049F18+ CCAAGCAGTACTCGCTGGCTTTCTTCTATGGAAGAATGTGCAGACCTATTCATTGACTAA
rJMSF038O15+ CCAAGCAGTACTCGCTGGCTTTCTTCTATGGAAGAATGTGCAGACCTATTCATTGACTAA
                      ____________________________________________________________
consensus CCAAGCAGTACTCGCTGGCTTTCTTCTATGGAAGAATGTGCAGACCTATTCATTGACTAA
 
. : . : . : . : . : . :
JMSF038O15- NAAAGTGTTTCCAACTGGCCTTTATGCTGCCATA
JMSF049F18- NAAAGTGTTTCCAACTGGCCTTTATGCTGCCATAAGTGCTGCAATGTTGTGCTTTTACTT
rJMSF049F18+ GAAAGTGTTTCCAACTGGCCTTTATGCTGCCATAAGTGCTGCAATGTTGTGCTTTTACTT
rJMSF038O15+ GAAAGTGTTTCCAACTGGCCTTTATGCTGCCATAAGTGCTGCAATGTTGTGCTTTTACTT
                      ____________________________________________________________
consensus GAAAGTGTTTCCAACTGGCCTTTATGCTGCCATAAGTGCTGCAATGTTGTGCTTTTACTT
 
. : . : . : . : . : . :
rJMSF049F18+ CTATGTGGTTATATCTGGGGGTAATCCACCACCGAAGAAAATGAAGTCATCTGCTGTAGC
rJMSF038O15+ CTATGTGGTTATATCTGGGGGTAATCCACCACCGAAGAAAATGAAGTCATCTGCTGTAGC
                      ____________________________________________________________
consensus CTATGTGGTTATATCTGGGGGTAATCCACCACCGAAGAAAATGAAGTCATCTGCTGTAGC
 
. : . : . : . : . : . :
rJMSF049F18+ TGCATCATAGCGTTCCAATCTCAGATTCAATCTTCAGAGAAATTTCTCTATGTTGAGGTT
rJMSF038O15+ TGCATCATAGCGTTCCAATCTCAGATTCAATCTTCAGAGAAATTTCTCTATGTTGAGGTT
                      ____________________________________________________________
consensus TGCATCATAGCGTTCCAATCTCAGATTCAATCTTCAGAGAAATTTCTCTATGTTGAGGTT
 
. : . : . : . : . : . :
rJMSF049F18+ GTCCAGGATTGGGTTGCTGGAGACCAAGACAATAGTAATATTATTTTGCACACGCTACAT
rJMSF038O15+ GTCCAGGATTGGGTTGCTGGAGACCAAGACAATAGTAATATTATTTTGCACACGCTACAT
                      ____________________________________________________________
consensus GTCCAGGATTGGGTTGCTGGAGACCAAGACAATAGTAATATTATTTTGCACACGCTACAT
 
. : . : . : . : . : . :
rJMSF049F18+ GTGAACAAGGAAAACAATGAGGAAATTTTTTGTTGGCTATGAACTATTTTGTGCTTAGTT
rJMSF038O15+ GTGAACAAGGAAAACAATGAGGAAATTTTTTGTTGGCTATGAACTATTTTGTGCTTAGTT
                      ____________________________________________________________
consensus GTGAACAAGGAAAACAATGAGGAAATTTTTTGTTGGCTATGAACTATTTTGTGCTTAGTT
 
. : . : . : . : . : . :
rJMSF049F18+ GATCTAATTGTTTAATATTCAGACTTTTATTATGTAATCTATGTATGGACCAATCAAAT
rJMSF038O15+ GATCTAATTGTTTAATATTCAGACTTTTATTATGTAATCTATGTATGGACCAATCAAATT
                      ____________________________________________________________
consensus GATCTAATTGTTTAATATTCAGACTTTTATTATGTAATCTATGTATGGACCAATCAAATT