Previous Contig 013190:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF007N24Sequence108007251 (3)717013190 (3)gb:AY519535_16109629e-47Arabidopsis thaliana MYB transcription factor (At1g07540) mRNA, complete cds.
JMSF038O09Sequence609007251 (3)gb:CRO251686_16734721e-09Catharanthus roseus mRNA for MYB-like DNA-binding protein (bpf-1 gene).855013190 (3)gb:AY519535_16109622e-47Arabidopsis thaliana MYB transcription factor (At1g07540) mRNA, complete cds.
JMSF046L03Sequence752007251 (3)gb:CRO251686_16734729e-11Catharanthus roseus mRNA for MYB-like DNA-binding protein (bpf-1 gene).716013190 (3)gb:AY519535_16109622e-24Arabidopsis thaliana MYB transcription factor (At1g07540) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF007N24+ TGCAGTGAATATGGCG
                      ____________________________________________________________
consensus TGCAGTGAATATGGCG
 
. : . : . : . : . : . :
rJMSF007N24+ GAGCCCCATGATGTGGTTCCGGTGAGGAAACCGAAGCGATCCGAGGCTGCACAACGCCGA
rJMSF038O09+ GTTCCGGTGAGGAAACCGAAGCGATCCGAGGCTGCACAACGCCGA
                      ____________________________________________________________
consensus GAGCCCCATGATGTGGTTCCGGTGAGGAAACCGAAGCGATCCGAGGCTGCACAACGCCGA
 
. : . : . : . : . : . :
rJMSF007N24+ ATTCGTCGACCTTTCTCTGTATCTGAAGTAGAAGCGCTTGTTCAAGCTGTCGAGAAGCTC
rJMSF038O09+ ATTCGTCGACCTTTCTCTGTATCTGAAGTAGAAGCGCTTGTTCAAGCTGTCGAGAAGCTC
                      ____________________________________________________________
consensus ATTCGTCGACCTTTCTCTGTATCTGAAGTAGAAGCGCTTGTTCAAGCTGTCGAGAAGCTC
 
. : . : . : . : . : . :
rJMSF007N24+ GGAACTGNCAGGTGGCGTGATGTTAAGCTGCGAGCTTTTGACAACG-CCAAACATAGAAC
rJMSF046L03+ CAGGTGGCGTGATGTTAAGCTGCGAGCTTTTGACAACGCCCAAACATAGAAC
rJMSF038O09+ GGAACTGGCAGGTGGCGTGATGTTAAGCTGCGAGCTTTTGACAACG-CCAAACATAGAAC
                      ____________________________________________________________
consensus GGAACTGGCAGGTGGCGTGATGTTAAGCTGCGAGCTTTTGACAACG-CCAAACATAGAAC
 
. : . : . : . : . : . :
rJMSF007N24+ CTATGTTGATTTGAAGGACAAATGGAAAACGCTAGTGCACACAGCGAGAATCTCCCCTCA
rJMSF046L03+ CTATGTTGATTTGAAGGACAAATGGAAAACGCTAGTGCACACAGCGAGAATCTCCCCTCA
rJMSF038O09+ CTATGTTGATTTGAAGGACAAATGGAAAACGCTAGTGCACACAGCGAGAATCTCCCCTCA
                      ____________________________________________________________
consensus CTATGTTGATTTGAAGGACAAATGGAAAACGCTAGTGCACACAGCGAGAATCTCCCCTCA
 
. : . : . : . : . : . :
rJMSF007N24+ GCAGAGGAGAGGCGAGCCAGTGCCCCAGGAGCTCTTGGACCGCGTCCTAATTGCTCACGC
rJMSF046L03+ GCAGAGGAGAGGCGAGCCAGTGCCCCAGGAGCTCTTGGACCGCGTCCTAATTGCTCACGC
rJMSF038O09+ GCAGAGGAGAGGCGAGCCAGTGCCCCAGGAGCTCTTGGACCGCGTCCTAATTGCTCACGC
                      ____________________________________________________________
consensus GCAGAGGAGAGGCGAGCCAGTGCCCCAGGAGCTCTTGGACCGCGTCCTAATTGCTCACGC
 
. : . : . : . : . : . :
rJMSF007N24+ ATACTGGTCCCAGCAGCAAGCGAAGCAGCAGATGAAACAGCAGGCCGAGACGTGCCTTCT
rJMSF046L03+ ATACTGGTCCCAGCAGCAAGCGAAGCAGCAGATGAAACAGCAGGCCGAGACGTGCCTTCT
rJMSF038O09+ ATACTGGTCCCAGCAGCAAGCGAAGCAGCAGATGAAACAGCAGGCCGAGACGTGCCTTCT
                      ____________________________________________________________
consensus ATACTGGTCCCAGCAGCAAGCGAAGCAGCAGATGAAACAGCAGGCCGAGACGTGCCTTCT
 
. : . : . : . : . : . :
rJMSF007N24+ CCTCTGAGAAAACACCGTGCTTGCTTCACAACACCGGGTTTGGAGATGGTTGTTCTACGA
rJMSF046L03+ CCTCTGAGAAAACACCGTGCTTGCTTCACAACACCGGGTTTGGAGATGGTTGTTCTACGA
rJMSF038O09+ CCTCTGAGAAAACACCGTGCNTGCTTCACAACACCGGGTTTGGAGATGGTTGTTCTACGA
                      ____________________________________________________________
consensus CCTCTGAGAAAACACCGTGCTTGCTTCACAACACCGGGTTTGGAGATGGTTGTTCTACGA
 
. : . : . : . : . : . :
rJMSF007N24+ TTATCTCTCGTTACTCTGTACTATAACATCTGTAAAAAAAAAGTGCGACGGGGAAGTTAG
rJMSF046L03+ TTATCTCTCGTTACTCTGTACTATAACATCTGTAAAAAAAAAGTGCGACGGGGAAGTTAG
rJMSF038O09+ TTATCTCTCGTTACTCTGTACTATAACATCTGTAAAAAAAAAGTGCGACGGGGAAGTTAG
                      ____________________________________________________________
consensus TTATCTCTCGTTACTCTGTACTATAACATCTGTAAAAAAAAAGTGCGACGGGGAAGTTAG
 
. : . : . : . : . : . :
rJMSF007N24+ AACCTAGTAAAATGCAGTATGTATGTAGCTTCTTCACACAGTGATTTCTCTCATGCTGGG
rJMSF046L03+ AACCTAGTAAAATGCAGTATGTATGTAGCTTCTTCACACAGTGATTTCTCTCATGCTGGG
rJMSF038O09+ AACCTAGTAAAATGCAGTATGTATGTAGCTTCTTCACACAGTGATTTCTCTCATGCTGGG
                      ____________________________________________________________
consensus AACCTAGTAAAATGCAGTATGTATGTAGCTTCTTCACACAGTGATTTCTCTCATGCTGGG
 
. : . : . : . : . : . :
rJMSF007N24+ AGGGGGGGTGGGGGGTGTGGTTGACATTACCTGTAAATAAGTGGTTGCTGACAGGGATTG
rJMSF046L03+ AGGGGGGGTGGGGGGTGGGGTTGACATTACCTGTAAATAAGTGGTTGCTGACAGGGATTG
rJMSF038O09+ AGGGGGGGTGGGGGGTGGGGTTGACATTACCTGTAAATAAGTGGTTGCTGACAGGGATTG
                      ____________________________________________________________
consensus AGGGGGGGTGGGGGGTGGGGTTGACATTACCTGTAAATAAGTGGTTGCTGACAGGGATTG
 
. : . : . : . : . : . :
rJMSF007N24+ TTTCTGGTGCCAGGGCCTGGCATTTTACTTGATCAAAATAAGTGTTTTGTTCTTTTGGGG
rJMSF046L03+ TTTCTGGTGCCAGGGCCTGGCATTTTACTTGATCAAAATAAGTGTTTTGTTCTTTTGGGG
rJMSF038O09+ TTTCTGGTGCCAGGGCCTGGCATTTTACTTGATCAAAATAAGTGTTTTGTTCTTTTGGGG
                      ____________________________________________________________
consensus TTTCTGGTGCCAGGGCCTGGCATTTTACTTGATCAAAATAAGTGTTTTGTTCTTTTGGGG
 
. : . : . : . : . : . :
rJMSF007N24+ TTTGGGTATTGTATTTACTGTGCCTAATATAGAAGAAAGGCA
rJMSF046L03+ TTTGGGTATTGTATTTACTGTGCCTAATATAGAAGAAAGGCAAAGCAAAGTGTAGAGCAT
rJMSF038O09+ TTTGGGTATTGTATTTACTGTGCCTAATATAGAAGAAAGGCAAAGCAAAGTGTAGAGCAT
                      ____________________________________________________________
consensus TTTGGGTATTGTATTTACTGTGCCTAATATAGAAGAAAGGCAAAGCAAAGTGTAGAGCAT
 
. : . : . : . : . : . :
rJMSF046L03+ ATTATATATATGTTGTAAGCTTTGATTCAGCAGTTGAGAAACATCATCTGCTTAACTAAA
rJMSF038O09+ ATTATATATATGTTGTAAGCTTTGATTCAGCAGTTGAGAAACATCATCTGCTTAACTAAA
                      ____________________________________________________________
consensus ATTATATATATGTTGTAAGCTTTGATTCAGCAGTTGAGAAACATCATCTGCTTAACTAAA
 
. : . : . : . : . : . :
rJMSF046L03+ CCCCATTCTAATTGGGGGTTGGGTAGGCTGCATACTTTTGTATTTCTCCATTC
rJMSF038O09+ CCCCATTCTAATTGGGGGTTGGGTAGGCTGCATACTTTTGTATTTCTCCATTCCTGTGTA
                      ____________________________________________________________
consensus CCCCATTCTAATTGGGGGTTGGGTAGGCTGCATACTTTTGTATTTCTCCATTCCTGTGTA