Previous Contig 013172:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF023M23Sequence596006174 (5)pir|T05209|T052091e-15hypothetical protein F24J7.50 - Arabidopsis thaliana>gb:ATCHRIV51_1545789 Arabid738013172 (2)gb:OSJN00184_16963642e-23Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0083I11, complete seque
JMSF038I13Sequence650006174 (5)pir|T05209|T052097e-24hypothetical protein F24J7.50 - Arabidopsis thaliana>gb:ATCHRIV51_1545789 Arabid939013172 (2)gb:OSJN00184_16963641e-38Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0083I11, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038I13+ GTCAAGTAATCAGTTTTCACATATGCTATTATACCTGAA
                      ____________________________________________________________
consensus GTCAAGTAATCAGTTTTCACATATGCTATTATACCTGAA
 
. : . : . : . : . : . :
rJMSF038I13+ ATCAAGAGGGTTCTATTCCTTAAAGTACCTGAAACCACGCAAAGGACTGTTGATGTTAGA
                      ____________________________________________________________
consensus ATCAAGAGGGTTCTATTCCTTAAAGTACCTGAAACCACGCAAAGGACTGTTGATGTTAGA
 
. : . : . : . : . : . :
rJMSF038I13+ GATTGATCGTGTAGCACAGGACTTCCAAGGTCCACAGAGATGAGATACATTCAAAGCTTG
                      ____________________________________________________________
consensus GATTGATCGTGTAGCACAGGACTTCCAAGGTCCACAGAGATGAGATACATTCAAAGCTTG
 
. : . : . : . : . : . :
rJMSF023M23+ TACGCAGTTTGCCACAAATGGTTGAGA
rJMSF038I13+ TACAGATTATGAGGGAACGATTGCTAATCCACCTACGCAGTTTGCCACAAATGGTTGAGA
                      ____________________________________________________________
consensus TACAGATTATGAGGGAACGATTGCTAATCCACCTACGCAGTTTGCCACAAATGGTTGAGA
 
. : . : . : . : . : . :
rJMSF023M23+ ACTGGAGTAGGCAAGAAGATACTGATTCACAGCCGAGTCAGTTTGTTCGTTCTATTACAA
rJMSF038I13+ ACTGGAGTAGGCAAGAAGATACTGATTCACAGCCGAGTCAGTTTGTTCGTTCTATTACAA
                      ____________________________________________________________
consensus ACTGGAGTAGGCAAGAAGATACTGATTCACAGCCGAGTCAGTTTGTTCGTTCTATTACAA
 
. : . : . : . : . : . :
rJMSF023M23+ AGGAAGTCGGTCTTCTTCAACGTGTGTTATCTCGAACTCTGCATGAAGTAGATGTTCAAA
rJMSF038I13+ AGGAAGTCGGTCTTCTTCAACGTGTGTTATCTCGAACTCTGCATGAAGTAGATGTTCAAA
                      ____________________________________________________________
consensus AGGAAGTCGGTCTTCTTCAACGTGTGTTATCTCGAACTCTGCATGAAGTAGATGTTCAAA
 
. : . : . : . : . : . :
rJMSF023M23+ CTATTTTCAGGCAAGTGGTGCAAATCTTTCACACCCAAATTTCAGAAGCACTGTCACGCG
rJMSF038I13+ CTATTTTCAGGCAAGTGGTGCAAATCTTTCACACCCAAATTTCAGAAGCACTGTCACGCG
                      ____________________________________________________________
consensus CTATTTTCAGGCAAGTGGTGCAAATCTTTCACACCCAAATTTCAGAAGCACTGTCACGCG
 
. : . : . : . : . : . :
rJMSF023M23+ TTGATATCAGTACTCCTCAAGTGAAGAACCGAATGCATCGTGATGTTCAACATATTCTCG
rJMSF038I13+ TTGATATCAGTACTCCTCAAGTGAAGAACCGAATGCATCGTGATGTTCAACATATTCTCG
                      ____________________________________________________________
consensus TTGATATCAGTACTCCTCAAGTGAAGAACCGAATGCATCGTGATGTTCAACATATTCTCG
 
. : . : . : . : . : . :
rJMSF023M23+ GGTGTATCAGATCATTGCCATCTGATGAATTGAGTAAATCAAATCCACCTAATTGGGGGA
rJMSF038I13+ GGTGTATCAGATCATTGCCATCTGATGAATTGAGTAAATCAAATCCACCTAATTGGGGGA
                      ____________________________________________________________
consensus GGTGTATCAGATCATTGCCATCTGATGAATTGAGTAAATCAAATCCACCTAATTGGGGGA
 
. : . : . : . : . : . :
rJMSF023M23+ AGCTTGATGAATTTGTGGAGCAAAATTTTGGTGCAGAAGCCAGTTAATAGGTTCCTTGTA
rJMSF038I13+ AGCTTGATGAATTTGTGGAGCAAAATTTTGGTGCAGAAGCCAGTTAATAGGTTCCTTGTA
                      ____________________________________________________________
consensus AGCTTGATGAATTTGTGGAGCAAAATTTTGGTGCAGAAGCCAGTTAATAGGTTCCTTGTA
 
. : . : . : . : . : . :
rJMSF023M23+ GATAGTTATTTGATAAATTGGATGCAGACTTCAGTGGTGTTTTAGGAGCAAATGAGCTAC
rJMSF038I13+ GATAGTTATTTGATAAATTGGATGCAGACTTCAGTGGTGTTTTAGGAGCAAATGAGCTAC
                      ____________________________________________________________
consensus GATAGTTATTTGATAAATTGGATGCAGACTTCAGTGGTGTTTTAGGAGCAAATGAGCTAC
 
. : . : . : . : . : . :
rJMSF023M23+ CAAGGATTTCCTGAAGCCCATGCATCAATGCTACACTAATGATGAGATGTGCAGTCTACT
rJMSF038I13+ CAAGGATTTCCTGAAGCCCATGCATCAATGCTACACTAATGATGAGATGTGCAGTCTACT
                      ____________________________________________________________
consensus CAAGGATTTCCTGAAGCCCATGCATCAATGCTACACTAATGATGAGATGTGCAGTCTACT
 
. : . : . : . : . : . :
rJMSF023M23+ GAATGGATATAGTACTACTGTAACAAATTCAAATTTTTGAAGTGAGAAAGATTCAATAGC
rJMSF038I13+ GAATGGATATAGTACTACTGTAACAAATTCAAATTTTTGAAGTGAGAAAGATTCAATAGC
                      ____________________________________________________________
consensus GAATGGATATAGTACTACTGTAACAAATTCAAATTTTTGAAGTGAGAAAGATTCAATAGC
 
. : . : . : . : . : . :
rJMSF023M23+ AACAGTTTGTAGTTTTCATGTACACAATTTGAAATGAGCCATATGTTTTTTTCTGAGATT
rJMSF038I13+ AACAGTTTGTAGTTTTCATGTACACAATTTGAAATGAGCCATATGTTTTTTTCTGAGATT
                      ____________________________________________________________
consensus AACAGTTTGTAGTTTTCATGTACACAATTTGAAATGAGCCATATGTTTTTTTCTGAGATT
 
. : . : . : . : . : . :
rJMSF023M23+ GTATTATTTCGGCTTCTTGGACTTCTGCCCTCTTCTCAAATTCCTTATTAATATATATAA
rJMSF038I13+ GTATTATTTCGGCTTCTTGGACTTCTGCCCTCTTCTCAAATTCCTTATTAATATATATAA
                      ____________________________________________________________
consensus GTATTATTTCGGCTTCTTGGACTTCTGCCCTCTTCTCAAATTCCTTATTAATATATATAA
 
. : . : . : . : . : . :
rJMSF023M23+ CTTAGGGCACCATATGTTCTCCCAGAAGGCTGAATAATTGCC
rJMSF038I13+ CTTAGGGCACCATATGTTCTCCCAGAAGGCTGAATAATTGCCCAACCATATCTTGTAATT
                      ____________________________________________________________
consensus CTTAGGGCACCATATGTTCTCCCAGAAGGCTGAATAATTGCCCAACCATATCTTGTAATT