Previous Contig 013166:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS024G05Sequence543013166 (2)gb:AP005116_18481606e-86Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P070
JMSF038H12Sequence525007218 (6)902013166 (2)gb:AY059877_15647212e-74Arabidopsis thaliana ABC transporter-like (At5g64940; MXK3.17) mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS024G05- AGAAGGCTTACTAGAAGTAT
                      ____________________________________________________________
consensus AGAAGGCTTACTAGAAGTAT
 
. : . : . : . : . : . :
JMFS024G05- TCTATGGGGTTTATGAGAAGGATCCAGATAAGGTTCTGCAAGCAATGGTTCAAATGGGTG
                      ____________________________________________________________
consensus TCTATGGGGTTTATGAGAAGGATCCAGATAAGGTTCTGCAAGCAATGGTTCAAATGGGTG
 
. : . : . : . : . : . :
JMFS024G05- TCCTTGTGCCCACTGGAGATATGACAGCTGTCAGGAGAACCGCTCAGTTCTTCCTTAACA
                      ____________________________________________________________
consensus TCCTTGTGCCCACTGGAGATATGACAGCTGTCAGGAGAACCGCTCAGTTCTTCCTTAACA
 
. : . : . : . : . : . :
JMFS024G05- GTTTTGAAGAGCGCCTTGCAACACAAAGGAGGGAGAGGGAGTTGGCTAAAGCAGAACTTG
                      ____________________________________________________________
consensus GTTTTGAAGAGCGCCTTGCAACACAAAGGAGGGAGAGGGAGTTGGCTAAAGCAGAACTTG
 
. : . : . : . : . : . :
JMFS024G05- GATTCAAAAAGCCTTTGACCAAGGAAGAAAAAATAGAGAAGAAAAAGCAACGTCTAGCTG
                      ____________________________________________________________
consensus GATTCAAAAAGCCTTTGACCAAGGAAGAAAAAATAGAGAAGAAAAAGCAACGTCTAGCTG
 
. : . : . : . : . : . :
JMFS024G05- CAATTGGTGAAGATCTATTATCCATTGCAGCAGATCAGCCTTTCCGCTTTCCTGCCACGT
rJMSF038H12+ GT
                      ____________________________________________________________
consensus CAATTGGTGAAGATCTATTATCCATTGCAGCAGATCAGCCTTTCCGCTTTCCTGCCACGT
 
. : . : . : . : . : . :
JMFS024G05- TCACTTTTGTTGTTAGAGCATTTTCAGTCTTACATGGCATCGGGAAGGGCCTTGATCCAC
rJMSF038H12+ TCACTTTTGTTGTTAGAGCATTTTCAGTCTTAGATGGCATCGGGAAGGGCCNTGATCCAC
                      ____________________________________________________________
consensus TCACTTTTGTTGTTAGAGCATTTTCAGTCTTAGATGGCATCGGGAAGGGCCTTGATCCAC
 
. : . : . : . : . : . :
JMFS024G05- GATTTGATATTACTGAGATTGCTAAGCCGTATGCACTAGAATTGCTTAGGTTTCGTGAAG
rJMSF038H12+ GATTTGATATTACTGAGATTGNTAAGCCGTATGCACTAGAATTGCTTAGGTTTCGTGAAG
                      ____________________________________________________________
consensus GATTTGATATTACTGAGATTGCTAAGCCGTATGCACTAGAATTGCTTAGGTTTCGTGAAG
 
. : . : . : . : . : . :
JMFS024G05- CTGGAGTTGAAGTTATTTTAAAGGACTTCAAAACAAGGTGGGACAGACAGAACCGTGCAT
rJMSF038H12+ CTGGAGTTGAAGTTATTTTAAAGGACTTCAAAACAAGGTGGGACAGACAGAACCGTGCAT
                      ____________________________________________________________
consensus CTGGAGTTGAAGTTATTTTAAAGGACTTCAAAACAAGGTGGGACAGACAGAACCGTGCAT
 
. : . : . : . : . : . :
JMFS024G05- TTTACAACCTATTCAGGCAGGCTGATAGGGTCGAAAAGCTTGC
rJMSF038H12+ TTTACAACCTATTCAGGCAGGCTGATAGGGTCGAAAAGCTTGCAGAAATTATCCAGCGAC
                      ____________________________________________________________
consensus TTTACAACCTATTCAGGCAGGCTGATAGGGTCGAAAAGCTTGCAGAAATTATCCAGCGAC
 
. : . : . : . : . : . :
rJMSF038H12+ TGGAGCAAGGTGATCTTAAACTTCGAGTTAGAGCTTTGGAGTCTGAACGGGCTTTTCAAC
                      ____________________________________________________________
consensus TGGAGCAAGGTGATCTTAAACTTCGAGTTAGAGCTTTGGAGTCTGAACGGGCTTTTCAAC
 
. : . : . : . : . : . :
rJMSF038H12+ GTGTTGCTGCTGTTCAAAAAACAATTTTAAGTGCAGTTGCAGCTGGAAGCTTAATTAACC
                      ____________________________________________________________
consensus GTGTTGCTGCTGTTCAAAAAACAATTTTAAGTGCAGTTGCAGCTGGAAGCTTAATTAACC
 
. : . : . : . : . : . :
rJMSF038H12+ TTGCGACAGTTTTGTATCTAAACGCTATAAGAATGCCTGCTATGGCTGCATACGGCTTAT
                      ____________________________________________________________
consensus TTGCGACAGTTTTGTATCTAAACGCTATAAGAATGCCTGCTATGGCTGCATACGGCTTAT
 
. : . : . : . : . : . :
rJMSF038H12+ GTGCATTTTTTGGCTTCCAAGTCCTAATCGGAATTGTGAAGGTTAAAAAGATAGATCAAC
                      ____________________________________________________________
consensus GTGCATTTTTTGGCTTCCAAGTCCTAATCGGAATTGTGAAGGTTAAAAAGATAGATCAAC
 
. : . : . : . : . : . :
rJMSF038H12+ GGGAAAGATTGATTACTGGAACTGCTTGAACACAAGTTGCAGATTCAGACCAGTCCCGAG
                      ____________________________________________________________
consensus GGGAAAGATTGATTACTGGAACTGCTTGAACACAAGTTGCAGATTCAGACCAGTCCCGAG
 
. : . : . : . : . : . :
rJMSF038H12+ ATTACTGGTGGGGGGGTCCTGTCCTCGTATGCCACTAACCTTGCAAATGCCACACAGGAT
                      ____________________________________________________________
consensus ATTACTGGTGGGGGGGTCCTGTCCTCGTATGCCACTAACCTTGCAAATGCCACACAGGAT
 
. : . : . : . : . : . :
rJMSF038H12+ AGTTGAGTAGCATTCAGAAACATTACAGGTGAATTCACAATTTTGATATGCTGAAGAAGA
                      ____________________________________________________________
consensus AGTTGAGTAGCATTCAGAAACATTACAGGTGAATTCACAATTTTGATATGCTGAAGAAGA
 
. : . : . : . : . : . :
rJMSF038H12+ CACTTGAAGCCTTCAGAGGCTACCCTGAAAACAAGGCTTTCAAGATACTGTCACTTGGGT
                      ____________________________________________________________
consensus CACTTGAAGCCTTCAGAGGCTACCCTGAAAACAAGGCTTTCAAGATACTGTCACTTGGGT
 
. : . : . : . : . : . :
rJMSF038H12+ TTAAATTGAGGATGTTACTTCTAGTTGGTCGAGGTTCAATTTTTTTTGTTTTGTTCTCAT
                      ____________________________________________________________
consensus TTAAATTGAGGATGTTACTTCTAGTTGGTCGAGGTTCAATTTTTTTTGTTTTGTTCTCAT
 
. : . : . : . : . : . :
rJMSF038H12+ ATTCATGGTTATTATACCATTCAACTGACCTTAGTCCCAGTGTATAGATAGTAACATAGA
                      ____________________________________________________________
consensus ATTCATGGTTATTATACCATTCAACTGACCTTAGTCCCAGTGTATAGATAGTAACATAGA
 
. : . : . : . : . : . :
rJMSF038H12+ TGTATAATCTGTTTATAACTGTGTATAATTATTGTGAGTTTCTGTACTCCAGATAATCTT
                      ____________________________________________________________
consensus TGTATAATCTGTTTATAACTGTGTATAATTATTGTGAGTTTCTGTACTCCAGATAATCTT