Previous Contig 013165:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF038H11Sequence634013165 (2)gb:AF233446_17794503e-84Physcomitrella patens rac 1 protein (rac1) mRNA, partial cds.851013165 (2)gb:AF115476_17693071e-85Physcomitrella patens rac-like GTP binding protein (rac2) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038H11- GGTACACTGGA
rJMSF038H11+ GGTACACTGGA
                      ____________________________________________________________
consensus GGTACACTGGA
 
. : . : . : . : . : . :
JMSF038H11- GTGGCCTCTCTCTCTGGGCAATTGAGCTGGCATATGAGGAAATGAATGCCACAGGTGGAA
rJMSF038H11+ GTGGCCTCTCTCTCTGGGCAATTGAGCTGGCATATGAGGAAATGAATGCCACAGGTGGAA
                      ____________________________________________________________
consensus GTGGCCTCTCTCTCTGGGCAATTGAGCTGGCATATGAGGAAATGAATGCCACAGGTGGAA
 
. : . : . : . : . : . :
JMSF038H11- TAGCCGCTGCGGCAGCTTCTACAAGCACAACTGCGACAAGCAGGTTCGTGAAATGTGTGA
rJMSF038H11+ TAGCCGCTGCGGCAGCTTCTACAAGCACAACTGCGACAAGCAGGTTCGTGAAATGTGTGA
                      ____________________________________________________________
consensus TAGCCGCTGCGGCAGCTTCTACAAGCACAACTGCGACAAGCAGGTTCGTGAAATGTGTGA
 
. : . : . : . : . : . :
JMSF038H11- CAGTGGGAGATGGAGCTGTTGGCAAGACTTGTCTTCTCATCTCCTACACCAGCAACACTT
rJMSF038H11+ CAGTGGGAGATGGAGCTGTTGGCAAGACTTGTCTTCTCATCTCCTACACCAGCAACACTT
                      ____________________________________________________________
consensus CAGTGGGAGATGGAGCTGTTGGCAAGACTTGTCTTCTCATCTCCTACACCAGCAACACTT
 
. : . : . : . : . : . :
JMSF038H11- TTCCAACGGATTATGTTCCCACGGTTTTTGACAATTTCAGTGCCAATGTCATGGTTGATG
rJMSF038H11+ TTCCAACGGATTATGTTCCCACGGTTTTTGACAATTTCAGTGCCAATGTCATGGTTGATG
                      ____________________________________________________________
consensus TTCCAACGGATTATGTTCCCACGGTTTTTGACAATTTCAGTGCCAATGTCATGGTTGATG
 
. : . : . : . : . : . :
JMSF038H11- GGAAGTCTGTGAATTTGGGTTTGTGGGATACTGCTGGACAAGAGGACTATAACAGGCTTA
rJMSF038H11+ GGAAGTCTGTGAATTTGGGTTTGTGGGATACTGCTGGACAAGAGGACTATAACAGGCTTA
                      ____________________________________________________________
consensus GGAAGTCTGTGAATTTGGGTTTGTGGGATACTGCTGGACAAGAGGACTATAACAGGCTTA
 
. : . : . : . : . : . :
JMSF038H11- GGCCCCTTAGCTATAGAGGAGCTGATGTCTTCCTCCTTGCATTCTCTCTGATAAGTAGGC
rJMSF038H11+ GGCCCCTTAGCTATAGAGGAGCTGATGTCTTCCTCCTTGCATTCTCTCTGATAAGTAGGC
                      ____________________________________________________________
consensus GGCCCCTTAGCTATAGAGGAGCTGATGTCTTCCTCCTTGCATTCTCTCTGATAAGTAGGC
 
. : . : . : . : . : . :
JMSF038H11- CTAGTTTTGAAAACATTTCAAAAAAG
rJMSF038H11+ CTAGTTTTGAAAACATTTCAAAAAAGTGGGTTCCAGAGCTAAGGCATTATGCACCTTCAG
                      ____________________________________________________________
consensus CTAGTTTTGAAAACATTTCAAAAAAGTGGGTTCCAGAGCTAAGGCATTATGCACCTTCAG
 
. : . : . : . : . : . :
rJMSF038H11+ TACCCATTGTTCTAGTGGGGACCAAACTGGATTTAAGAGAAGACAAGCAGTTTAAAAGGG
                      ____________________________________________________________
consensus TACCCATTGTTCTAGTGGGGACCAAACTGGATTTAAGAGAAGACAAGCAGTTTAAAAGGG
 
. : . : . : . : . : . :
rJMSF038H11+ ATTATCCAGGGGCATGTACAATATCAACTGAGCAGGGTGAAGAGTTGAGAAGGCAAATGG
                      ____________________________________________________________
consensus ATTATCCAGGGGCATGTACAATATCAACTGAGCAGGGTGAAGAGTTGAGAAGGCAAATGG
 
. : . : . : . : . : . :
rJMSF038H11+ GAGCTGTGGCATATGTTGAGTGTAGTGCCAAAACACAGCAGAATGTTAAAGCTGTTTTTG
                      ____________________________________________________________
consensus GAGCTGTGGCATATGTTGAGTGTAGTGCCAAAACACAGCAGAATGTTAAAGCTGTTTTTG
 
. : . : . : . : . : . :
rJMSF038H11+ ACGCTGCAATTAAGGCGGTTCTGCAACCTTCAAAATCCAAGAAACAGAAAAGAAAATATA
                      ____________________________________________________________
consensus ACGCTGCAATTAAGGCGGTTCTGCAACCTTCAAAATCCAAGAAACAGAAAAGAAAATATA
 
. : . : . : . : . : . :
rJMSF038H11+ AAGCATGTCGTATTCTCTGATCTGATCAAATACATTTGAGGTTATACTCCTGCATGTATA
                      ____________________________________________________________
consensus AAGCATGTCGTATTCTCTGATCTGATCAAATACATTTGAGGTTATACTCCTGCATGTATA
 
. : . : . : . : . : . :
rJMSF038H11+ TATAGCTAATAGCTCTAAAATATGATTCTTAATTTCTCCTTTGGAATCGAGTCTTTGTTT
                      ____________________________________________________________
consensus TATAGCTAATAGCTCTAAAATATGATTCTTAATTTCTCCTTTGGAATCGAGTCTTTGTTT
 
. : . : . : . : . : . :
rJMSF038H11+ TTCGTATTATTGTCAATTTATTCGATTATGTTTAATTTTCAATGTTTAGAAATGCCCTGA
                      ____________________________________________________________
consensus TTCGTATTATTGTCAATTTATTCGATTATGTTTAATTTTCAATGTTTAGAAATGCCCTGA