Previous Contig 013159:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006H03Sequence582000322 (3)gb:AY070444_15668302e-42Arabidopsis thaliana unknown protein (At3g16310) mRNA, complete cds.778013159 (3)gb:AB023046_15155368e-58Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6.>gb:ATAC001645_15
JMFF049F19Sequence558000322 (3)gb:AY070444_15668301e-40Arabidopsis thaliana unknown protein (At3g16310) mRNA, complete cds.596013159 (3)gb:AB023046_15155365e-20Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6.>gb:ATAC001645_15
JMSF038G18Sequence640000322 (3)gb:AY070444_15668301e-57Arabidopsis thaliana unknown protein (At3g16310) mRNA, complete cds.928013159 (3)gb:AB023046_15155361e-51Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6.>gb:ATAC001645_15

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006H03+ AGGG
                      ____________________________________________________________
consensus AGGG
 
. : . : . : . : . : . :
rJMFF006H03+ AAGTTGCAAGGCCAGAGATAAAGAAGAATTCAATACCCGTGGGTAACCTGGATGAGGAGG
rJMSF038G18+ ATACCCGNGGGTAACCTGGATGAGGAGG
                      ____________________________________________________________
consensus AAGTTGCAAGGCCAGAGATAAAGAAGAATTCAATACCCGTGGGTAACCTGGATGAGGAGG
 
. : . : . : . : . : . :
rJMFF006H03+ AGTGGGTCACTGTATATGGGTTTTCTCCAGCTGAGACCAATTTAGTTTTGCGAGAATTTG
rJMSF038G18+ AGTGGGTCACTGTATATGGGTTTTCTCCAGCTGAGACCAATTTAGTTTTGCGAGAATTTG
                      ____________________________________________________________
consensus AGTGGGTCACTGTATATGGGTTTTCTCCAGCTGAGACCAATTTAGTTTTGCGAGAATTTG
 
. : . : . : . : . : . :
rJMFF006H03+ AAAAGTGTGGTGTTATTCTGAAACACATTCCTGGTCCCCGGAATGCTAATTGGATGCACA
rJMSF038G18+ AAAAGTGTGGTGTTATTCTGAAACACATTCCTGGTCCCCGGAATGCTAATNGGATGCACA
                      ____________________________________________________________
consensus AAAAGTGTGGTGTTATTCTGAAACACATTCCTGGTCCCCGGAATGCTAATTGGATGCACA
 
. : . : . : . : . : . :
rJMFF006H03+ TTTTGTATCAGAATCGTGCTGATGCACATAAAGCTCTTAGCAAAAATGGGATGCAAATAA
rJMFF049F19+ CTGATGCACATAAAGCTCTTAGCAAAAATGGGATGCAAATAA
rJMSF038G18+ TTTTGTATCAGAATCGTGCTGATGCACATAAAGCTCTTAGCAAAAATGGGATGCAAATAA
                      ____________________________________________________________
consensus TTTTGTATCAGAATCGTGCTGATGCACATAAAGCTCTTAGCAAAAATGGGATGCAAATAA
 
. : . : . : . : . : . :
rJMFF006H03+ ACGGAGTTCTTATTATTGGAGTGAAACCAGTGGATCCAATGCAACGTCAAGGCCTGACCG
rJMFF049F19+ ACGGAGTTCTTATTATTGGAGTGAAACCAGTGGATCCAATGCAACGTCAAGGCCTGACCG
rJMSF038G18+ ACGGAGTTCTTATTATTGGAGTGAAACCAGTGGATCCAATGCAACGTCAAGGCCTGACCG
                      ____________________________________________________________
consensus ACGGAGTTCTTATTATTGGAGTGAAACCAGTGGATCCAATGCAACGTCAAGGCCTGACCG
 
. : . : . : . : . : . :
rJMFF006H03+ AAAGGCTTAACAATCATGGATTTGTACCTTTACCCCTTGCACCCTCGAGCAAAACCCCAG
rJMFF049F19+ AAAGGCTTAACAATCATGGATTTGTACCTTTACCCCTTGCACCCTCGAGCAAAACCCCAG
rJMSF038G18+ AAAGGCTTAACAATCATGGATTTGTACCTTTACCCCTTGCACCCTCGAGCAAAACCCCAG
                      ____________________________________________________________
consensus AAAGGCTTAACAATCATGGATTTGTACCTTTACCCCTTGCACCCTCGAGCAAAACCCCAG
 
. : . : . : . : . : . :
rJMFF006H03+ ATTCTATCCCCTTCAGAACGTCTTCACAGCCACACTACCTTCAGAATGGCAGTAGCAGTG
rJMFF049F19+ ATTCTATCCCCTTCAGAACGTCTTCACAGCCACACTACCTTCAGAATGGCAGTAGCAGTG
rJMSF038G18+ ATTCTATCCCCTTCAGAACGTCTTCACAGCCACACTACCTTCAGAATGGCAGTAGCAGTG
                      ____________________________________________________________
consensus ATTCTATCCCCTTCAGAACGTCTTCACAGCCACACTACCTTCAGAATGGCAGTAGCAGTG
 
. : . : . : . : . : . :
rJMFF006H03+ GCAGACAGTCTGCTGGAACGGTCGCAGCACCAGCCAAATCTGTAGTGTCCAAAGTCATGG
rJMFF049F19+ GCAGACAGTCTGCTGGAACGGTCGCAGCACCAGCCAAATCTGTAGTGTCCAAAGTCATGG
rJMSF038G18+ GCAGACAGTCTGCTGGAACGGTCGCAGCACCAGCCAAATCTGTAGTGTCCAAAGTCATGG
                      ____________________________________________________________
consensus GCAGACAGTCTGCTGGAACGGTCGCAGCACCAGCCAAATCTGTAGTGTCCAAAGTCATGG
 
. : . : . : . : . : . :
rJMFF006H03+ ACTTAATGTTTGGCGTCTAGTTGCATTCTCAGCACTATATCATGCCATGCTTCCTACATC
rJMFF049F19+ ACTTAATGTTTGGCGTCTAGTTGCATTCTCAGCACTATATCATGCCATGCTTCCTACATC
rJMSF038G18+ ACTTAATGTTTGGCGTCTAGTTGCATTCTCAGCACTATATCATGCCATGCTTCCTACATC
                      ____________________________________________________________
consensus ACTTAATGTTTGGCGTCTAGTTGCATTCTCAGCACTATATCATGCCATGCTTCCTACATC
 
. : . : . : . : . : . :
rJMFF006H03+ CTATTGATCTTTTATATACATTGCTTTTCCAAGATGAATCACAATTGTAATCTCATCGTG
rJMFF049F19+ CTATTGATCTTTTATATACATTGCTTTTCCAAGATGAATCACAATTGTAATCTCATCGTG
rJMSF038G18+ CTATTGATCTTTTATATACATTGCTTTTCCAAGATGAATCACAATTGTAATCACATCGTG
                      ____________________________________________________________
consensus CTATTGATCTTTTATATACATTGCTTTTCCAAGATGAATCACAATTGTAATCTCATCGTG
 
. : . : . : . : . : . :
rJMFF006H03+ CCCTGTTGAGATTTGAATCTGTATTTTGCGGAGTCTTTTTCACTTAGGTCGGGTTACTTG
rJMFF049F19+ CCCTGTTGAGATTTGAATCTGTATTTTGCGGAGTCTTTTTCACTTAGGTCGGGTTACTTG
rJMSF038G18+ CCCTGTTGAGATTTGAATCTGTATTTTGCGGAGTCTTTTTCACTTAGGTCGGGTTACTTG
                      ____________________________________________________________
consensus CCCTGTTGAGATTTGAATCTGTATTTTGCGGAGTCTTTTTCACTTAGGTCGGGTTACTTG
 
. : . : . : . : . : . :
rJMFF006H03+ AACAAAAGATGGTATGCTATATTTATATGTTGAAATTCTGTCAAAGTGACAGGTTGAAAT
rJMFF049F19+ AACAAAAGATGGTATGCTATATTTATATGTTGAAATTCTGTCAAAGTGACAGGTTGAAAT
rJMSF038G18+ AACAAAAGATGGTATGCTATATTTATATGTTGAAATTCTGTCAAAGTGACAGGTTGAAAT
                      ____________________________________________________________
consensus AACAAAAGATGGTATGCTATATTTATATGTTGAAATTCTGTCAAAGTGACAGGTTGAAAT
 
. : . : . : . : . : . :
rJMFF006H03+ CAACTTGTTATTTCTTGTTTCTCTGTTAATCTGAACCTTCTGCTCATCACAGTA
rJMFF049F19+ CAACTTGTTATTTCTTGTTTCTCTGTTAATCTGAACCTTCTGCTCATCACAGTATGTTAC
rJMSF038G18+ CAACTTGTTATTTCTTGTTTCTCTGTTAATCTGAACCTTCTGCTCATCACAGTATGTTAC
                      ____________________________________________________________
consensus CAACTTGTTATTTCTTGTTTCTCTGTTAATCTGAACCTTCTGCTCATCACAGTATGTTAC
 
. : . : . : . : . : . :
rJMFF049F19+ TGAAAATTTTGGGG
rJMSF038G18+ TGAAAATTTTGGGGAAAGAGAAAAGCAACACGACAACTCTGTTCTGTCACCGGGAGCAGA
                      ____________________________________________________________
consensus TGAAAATTTTGGGGAAAGAGAAAAGCAACACGACAACTCTGTTCTGTCACCGGGAGCAGA
 
. : . : . : . : . : . :
rJMSF038G18+ TTTGTTCATATGAATATAGGTGTTGGTTTACAATATTTTCAGTGTCGATGAGCATTTAAC
                      ____________________________________________________________
consensus TTTGTTCATATGAATATAGGTGTTGGTTTACAATATTTTCAGTGTCGATGAGCATTTAAC
 
. : . : . : . : . : . :
rJMSF038G18+ AAATATTATGAGGAATTCTACTATATAGACTTTTAATCTGTACTTCCTCGCTAGAGATGA
                      ____________________________________________________________
consensus AAATATTATGAGGAATTCTACTATATAGACTTTTAATCTGTACTTCCTCGCTAGAGATGA