Previous Contig 013153:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF038F03Sequence673013153 (2)gb:AP000366_18197448e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P043939013153 (2)gb:OSJN00091_16947411e-77Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0087O24, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF038F03- GAGGGTTCCGATAT
                      ____________________________________________________________
consensus GAGGGTTCCGATAT
 
. : . : . : . : . : . :
JMSF038F03- ACTCTTCTCTTCCGGCCTTCTCTTTCTTCTCTTCGACGCCACCATTCTCTCTCTACAACT
                      ____________________________________________________________
consensus ACTCTTCTCTTCCGGCCTTCTCTTTCTTCTCTTCGACGCCACCATTCTCTCTCTACAACT
 
. : . : . : . : . : . :
JMSF038F03- CTCTACTTTCTCTCCTCCGAATCTTCAACCCTACAACTAATTTCTTTCGCAATGGAGTTC
                      ____________________________________________________________
consensus CTCTACTTTCTCTCCTCCGAATCTTCAACCCTACAACTAATTTCTTTCGCAATGGAGTTC
 
. : . : . : . : . : . :
JMSF038F03- GGAGGAGCTCGGAAGAGAGGAAGATTCGACGCCGGCTTGAACGGCAATGGCGGCTACAAG
                      ____________________________________________________________
consensus GGAGGAGCTCGGAAGAGAGGAAGATTCGACGCCGGCTTGAACGGCAATGGCGGCTACAAG
 
. : . : . : . : . : . :
JMSF038F03- AAATCCAGACAAGAATCAGAGTATTCAAGTGGTATAGGGAGCAAATCAAAGCCATGCACA
rJMSF038F03+ GTATTCAAGTGGTATAGGGAGC-AATCAAAGCCATGCACA
                      ____________________________________________________________
consensus AAATCCAGACAAGAATCAGAGTATTCAAGTGGTATAGGGAGCAAATCAAAGCCATGCACA
 
. : . : . : . : . : . :
JMSF038F03- AAGTTTTTCAGTACCTCAGGATGCCAATTTGGAGAGAGCTGCCACTTTTTGCATTATGTG
rJMSF038F03+ AAGTTTTTCAGTACCTCAGGATGCCAATTTGGAGAGAGCTGCCACTTTTTGCATTATGTG
                      ____________________________________________________________
consensus AAGTTTTTCAGTACCTCAGGATGCCAATTTGGAGAGAGCTGCCACTTTTTGCATTATGTG
 
. : . : . : . : . : . :
JMSF038F03- CCTGGTGGGCTCAAATCTGTGACTCAAATGCTTGGCAACAATCCTGCTCTGCCTGTGGCT
rJMSF038F03+ CCTGGTGGGCTCAAATCTGTGACTCAAATGCTTGGCAACAATCCTGCTCTGCCTGTGGCT
                      ____________________________________________________________
consensus CCTGGTGGGCTCAAATCTGTGACTCAAATGCTTGGCAACAATCCTGCTCTGCCTGTGGCT
 
. : . : . : . : . : . :
JMSF038F03- ACTAGAAACTCTATGGCCATGCCGTCTTTCCCAGATGCACCATCTCCAACAGGTGTTAAG
rJMSF038F03+ ACTAGAAACTCTATGGCCATGCCGTCTTTCCCAGATGCACCATCTCCAACAGGTGTTAAG
                      ____________________________________________________________
consensus ACTAGAAACTCTATGGCCATGCCGTCTTTCCCAGATGCACCATCTCCAACAGGTGTTAAG
 
. : . : . : . : . : . :
JMSF038F03- ACTCGTTTATGCACCAAATACAACTCAGCTGAGGGTTGCAAATTTGGTGACAAGTGCCAT
rJMSF038F03+ ACTCGTTTATGCACCAAATACAACTCAGCTGAGGGTTGCAAATTTGGTGACAAGTGCCAT
                      ____________________________________________________________
consensus ACTCGTTTATGCACCAAATACAACTCAGCTGAGGGTTGCAAATTTGGTGACAAGTGCCAT
 
. : . : . : . : . : . :
JMSF038F03- TTTGCACATGGTGAGTGGGAACTTGGCAGGTCAGCACTTCCTGCTCATGAGGACCCTCGT
rJMSF038F03+ TTTGCACATGGTGAGTGGGAACTTGGCAGGTCAGCACTTCCTGCTCATGAGGACCCTCGT
                      ____________________________________________________________
consensus TTTGCACATGGTGAGTGGGAACTTGGCAGGTCAGCACTTCCTGCTCATGAGGACCCTCGT
 
. : . : . : . : . : . :
JMSF038F03- GGAATGGGTCATGCGTCTAGGTTTGGTAGACCTGAGCCAAGTCAAGCCGGGCTTGGAGCA
rJMSF038F03+ GGAATGGGTCATGCGTCTAGGTTTGGTAGACCTGAGCCAAGTCAAGCCGGGCTTGGAGCA
                      ____________________________________________________________
consensus GGAATGGGTCATGCGTCTAGGTTTGGTAGACCTGAGCCAAGTCAAGCCGGGCTTGGAGCA
 
. : . : . : . : . : . :
JMSF038F03- GCTGCAAGCTTTGGTTCATCTGCCACAGCTAAGATAAGTATCGATGCTTCTCTGTCTGG
rJMSF038F03+ GCTGCAAGCTTTGGTTCATCTGCCACAGCTAAGATAAGTATCGATGCTTCTCTGTCTGGA
                      ____________________________________________________________
consensus GCTGCAAGCTTTGGTTCATCTGCCACAGCTAAGATAAGTATCGATGCTTCTCTGTCTGGA
 
. : . : . : . : . : . :
rJMSF038F03+ GCCATAATCGGAAAAGGTGGTGTAAACTCAAAGCAGATATGCCGTGTGACTGGAGCCAAG
                      ____________________________________________________________
consensus GCCATAATCGGAAAAGGTGGTGTAAACTCAAAGCAGATATGCCGTGTGACTGGAGCCAAG
 
. : . : . : . : . : . :
rJMSF038F03+ CTCTCAATAAGGGATAATGAATCTGATCCTAACTTGAAGAACATTGAACTTGAAGGTACA
                      ____________________________________________________________
consensus CTCTCAATAAGGGATAATGAATCTGATCCTAACTTGAAGAACATTGAACTTGAAGGTACA
 
. : . : . : . : . : . :
rJMSF038F03+ ATTGACCAGATTCAGCAAGCCAGTCAAATGGTTCGGGAGCTTATAGCAACAGTCAGTTCA
                      ____________________________________________________________
consensus ATTGACCAGATTCAGCAAGCCAGTCAAATGGTTCGGGAGCTTATAGCAACAGTCAGTTCA
 
. : . : . : . : . : . :
rJMSF038F03+ AATGCAAAATCCATGAAAGGACCACGCTCTGCTCCAGCAAACAACTATAAAACGAAACTT
                      ____________________________________________________________
consensus AATGCAAAATCCATGAAAGGACCACGCTCTGCTCCAGCAAACAACTATAAAACGAAACTT
 
. : . : . : . : . : . :
rJMSF038F03+ TGTGACAATTTTGTGAAAGGCTCATGCACTTTTGGTGATAGGTGCCACTTTGCACATGGA
                      ____________________________________________________________
consensus TGTGACAATTTTGTGAAAGGCTCATGCACTTTTGGTGATAGGTGCCACTTTGCACATGGA
 
. : . : . : . : . : . :
rJMSF038F03+ GCCGAAGAGCTGCGTGGCGGTGGAATGTGAGCTTTGGAGTTTTAATTCAGGATTATTGTT
                      ____________________________________________________________
consensus GCCGAAGAGCTGCGTGGCGGTGGAATGTGAGCTTTGGAGTTTTAATTCAGGATTATTGTT
 
. : . : . : . : . : . :
rJMSF038F03+ TCATGTGTAGTACTTTGGTGCATAATCATGTGGCTGTAGTTTGTTATTTTTATTTTTATT
                      ____________________________________________________________
consensus TCATGTGTAGTACTTTGGTGCATAATCATGTGGCTGTAGTTTGTTATTTTTATTTTTATT
 
. : . : . : . : . : . :
rJMSF038F03+ TTTGTTTTGTCTGGGATTGATCTCATTATAGATGGAATGTTAAAATTGCATTAGGTTTTG
                      ____________________________________________________________
consensus TTTGTTTTGTCTGGGATTGATCTCATTATAGATGGAATGTTAAAATTGCATTAGGTTTTG