Previous Contig 013152:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF038E21Sequence463013472 (4)gb:AC092781_17357472e-26Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.840013152 (2)gb:AB011479_15114492e-05Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNA5.
JMSF038H01Sequence466013472 (4)gb:AC092781_17357472e-26Oryza sativa chromosome 3 BAC OSJNBb0094O03 genomic sequence, complete sequence.875013152 (2)gb:AB011479_15114492e-05Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNA5.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038H01+ CGAAGAAGAAAGCTCGGCCCCCCAGATCTGAGCTC
                      ____________________________________________________________
consensus CGAAGAAGAAAGCTCGGCCCCCCAGATCTGAGCTC
 
. : . : . : . : . : . :
rJMSF038H01+ TCAAGAGGATGGGCTCGAGTGGCTCCCTCTTCTAGCTGCGGTTTCCGTGTATAATTCTCC
rJMSF038E21+ TCAAGAGGATGGGCTCGAGTGGCTCCCTCTTCTAGCTGCGGTTTCCGTGTATAATTCTCC
                      ____________________________________________________________
consensus TCAAGAGGATGGGCTCGAGTGGCTCCCTCTTCTAGCTGCGGTTTCCGTGTATAATTCTCC
 
. : . : . : . : . : . :
rJMSF038H01+ CAGAAGGATGAACTCGAAGAAATCTTCAATCTGCACAGTGGGGCAGCACTCCATTCCTTA
rJMSF038E21+ CAGAAGGATGAACTCGAAGAAATCTTCAATCTGCACAGTGGGGCAGCACTCCATTCCTTA
                      ____________________________________________________________
consensus CAGAAGGATGAACTCGAAGAAATCTTCAATCTGCACAGTGGGGCAGCACTCCATTCCTTA
 
. : . : . : . : . : . :
rJMSF038H01+ ACTTTCCTCTTCCGCACTTCTATTCGGTCAAATGGGAGGATGTAGAAATAAAAAATCCCA
rJMSF038E21+ ACTTTCCTCTTCCGCACTTCTATTCGGTCAAATGGGAGGATGTAGAAATAAAAAATCCCA
                      ____________________________________________________________
consensus ACTTTCCTCTTCCGCACTTCTATTCGGTCAAATGGGAGGATGTAGAAATAAAAAATCCCA
 
. : . : . : . : . : . :
rJMSF038H01+ GTGAGAAGTGCCCAAAAATTTCTCTCTTGCTCAACAAAAAATTGCACAAAAGTTCTACTC
rJMSF038E21+ GTGAGAAGTGCCCAAAAATTTCTCTCTTGCTCAACAAAAAATTGCACAAAAGTTCTACTC
                      ____________________________________________________________
consensus GTGAGAAGTGCCCAAAAATTTCTCTCTTGCTCAACAAAAAATTGCACAAAAGTTCTACTC
 
. : . : . : . : . : . :
rJMSF038H01+ TTTCCAGTTTAGTTCAGGTTGTTTTCCTGAAATCTTGAAGACACGGGGGATTTAATATAT
rJMSF038E21+ TTTCCAGTTTAGTTCAGGTTGTTTTCCTGAAATCTTGAAGACACGGGGGATTTAATATAT
                      ____________________________________________________________
consensus TTTCCAGTTTAGTTCAGGTTGTTTTCCTGAAATCTTGAAGACACGGGGGATTTAATATAT
 
. : . : . : . : . : . :
rJMSF038H01+ TGACAGAGGAAGGAGAAGCAATTTCTGTCGCCAGTGGGCAGCAAGGATGCTATAAGATTC
rJMSF038E21+ TGACAGAGGAAGGAGAAGCAATTTCTGTCGCCAGTGGGCAGCAAGGATGCTATAAGATTC
                      ____________________________________________________________
consensus TGACAGAGGAAGGAGAAGCAATTTCTGTCGCCAGTGGGCAGCAAGGATGCTATAAGATTC
 
. : . : . : . : . : . :
rJMSF038H01+ CCTAAAGAAAATGGAAATAGCAAGGAAAAGGGTGTTATACTTGAAAAACTCAAGCACTCA
rJMSF038E21+ CCTAAAGAAAATGGAAATAGCAAGGAAAAAGGTGTTATACTTGAAAAACTCAAGCACTCA
                      ____________________________________________________________
consensus CCTAAAGAAAATGGAAATAGCAAGGAAAAGGGTGTTATACTTGAAAAACTCAAGCACTCA
 
. : . : . : . : . : . :
rJMSF038H01+ AAGAGTCAAAGGGGGAAGAACATGGCGATAGAGGTAGTGGTTGTGATGAAAAGCTGTGAT
rJMSF038E21+ AAGAGTCAAAGGGGGAAGAACATGGCGATAGAGGTAGTGGTTGTGATGAAAAGCTGTGAT
                      ____________________________________________________________
consensus AAGAGTCAAAGGGGGAAGAACATGGCGATAGAGGTAGTGGTTGTGATGAAAAGCTGTGAT
 
. : . : . : . : . : . :
rJMSF038H01+ TTCTAGCATAGAAGAGAAGAAATGTGTTTGAAGGTGTCAAGTCCATCACCCCAAGGGCAA
rJMSF038E21+ TTCTAGCATAGAAGAGAAGAAATGTGTTTGAAGGTGTCAAGTCCATCACCCCAAGGGCAA
                      ____________________________________________________________
consensus TTCTAGCATAGAAGAGAAGAAATGTGTTTGAAGGTGTCAAGTCCATCACCCCAAGGGCAA
 
. : . : . : . : . : . :
rJMSF038H01+ ACTATATTAAGAGAACCCTAGCTGGAGAATATCTCACATCTGCCTTAAATGATTTTGGTC
rJMSF038E21+ ACTATATTAAGAGAACCCTAGCTGGAGAATATCTCACATCTGCCTTAAATGATTTTGGTC
                      ____________________________________________________________
consensus ACTATATTAAGAGAACCCTAGCTGGAGAATATCTCACATCTGCCTTAAATGATTTTGGTC
 
. : . : . : . : . : . :
rJMSF038H01+ CTGAACAATATGACAGCCTTGCTGGCTGCTGCTATATCTGATGGAGCAAACAAGCTTTTA
rJMSF038E21+ CTGAACAATATGACAGCCTTGCTGGCTGCTGCTATATCTGATGGAGCAAACAAGCTTTTA
                      ____________________________________________________________
consensus CTGAACAATATGACAGCCTTGCTGGCTGCTGCTATATCTGATGGAGCAAACAAGCTTTTA
 
. : . : . : . : . : . :
rJMSF038H01+ ATGTTGGTATGGTTATTTTACTCTATCATATACTCATTTAGTAATTTTGACTAAAGTATG
rJMSF038E21+ ATGTTGGTATGGTTATTTTACTCTATCATATACTCATTTAGTAATTTTGACTAAAGTATG
                      ____________________________________________________________
consensus ATGTTGGTATGGTTATTTTACTCTATCATATACTCATTTAGTAATTTTGACTAAAGTATG
 
. : . : . : . : . : . :
rJMSF038H01+ TGTTCCAACTCCAATTAAAGTTTAAGCTATTTGTAAGAATACACATGTCACAGCATTATC
rJMSF038E21+ TGTTCCAACTCCAATTAAAGTTTAAGCTATTTGTAAGAATACACATGTCACAGCATTATC
                      ____________________________________________________________
consensus TGTTCCAACTCCAATTAAAGTTTAAGCTATTTGTAAGAATACACATGTCACAGCATTATC
 
. : . : . : . : . : . :
rJMSF038H01+ TTGTTTAGAGTAAGTAATCTTTAATTGTAGTTTTAGATCAAGAATGAAGTGTTCCATTCT
rJMSF038E21+ TTGTTTAGAGTAAGTAATCTTTAATTGTAGTTTTAGATCAAGAATGAAGTGTTCCATTCT
                      ____________________________________________________________
consensus TTGTTTAGAGTAAGTAATCTTTAATTGTAGTTTTAGATCAAGAATGAAGTGTTCCATTCT