Previous Contig 013145:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN030K01Sequence617013145 (4)gb:AP003507_18300584e-64Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P046
JMFS052A07Sequence184013145 (4)
JMSF038D12Sequence608007978 (2)gb:AP003507_18300581e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P046896013145 (4)gb:AP003507_18300587e-96Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P046
JMSF050D02Sequence681007978 (2)gb:AP003507_18300582e-13Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P046742013145 (4)gb:AP003507_18300584e-66Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P046

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS052A07+ CATAATGGTTCAATTCCTTTTGATTTGCTTGCCCAATGC
JMFN030K01+ TGATTTGCTTGCCCAATGC
                      ____________________________________________________________
consensus CATAATGGTTCAATTCCTTTTGATTTGCTTGCCCAATGC
 
. : . : . : . : . : . :
JMFS052A07+ TATATGTCATCATTTATACATATACACAGAAAGATCCCTCATCTCTAACTAAGCAGTCCG
JMFN030K01+ TATATGTCATCATTTATACATATACACAGAAAGATCCCTCATCTCTAACTAAGCAGACCG
rJMSF050D02- TGTCATCATTTATACATATACACAGAAAGATCCCTCATCTCTAACTAAGCAGACCG
rJMSF038D12- TGTCATCATTTATACATATACACAGAAAGATCCCTCATCTCTAACTAAGCAGACCG
                      ____________________________________________________________
consensus TATATGTCATCATTTATACATATACACAGAAAGATCCCTCATCTCTAACTAAGCAGACCG
 
. : . : . : . : . : . :
JMFS052A07+ TATGCCAAGAATCTTTCCAGTGGTTTTGATCATGTTTGTTCTGTACAAGGTGGTATGTTT
JMFN030K01+ GATGCTAAGAATCTTTCCAGTGGTTTTGATCTTGTTTGTTCTGTACAAGGTGGTATGTTT
rJMSF050D02- GATGCCAAGAATCTTTCCAGTGGTTTTGATCTTGTTTGTTCTGTACAAGGTGGTATGTTT
rJMSF038D12- GATGCCAAGAATCTTTCCAGTGGTTTTGATCTTGTTTGTTCTGTACAAGGTGGTATGTTT
                      ____________________________________________________________
consensus GATGCCAAGAATCTTTCCAGTGGTTTTGATCTTGTTTGTTCTGTACAAGGTGGTATGTTT
 
. : . : . : . : . : . :
JMFS052A07+ CTATGAAAGATGTACAAGATTAAAG
JMFN030K01+ CTATGAAAGATGTACAAGATTAAAGACAATATCCAACTCACGCTCGGCTACCATGATGCA
rJMSF050D02- CTATGAAAGATGTACAAGATTAAAGACAATATCCAACTCACGCTCGGCTACCATGATGCA
rJMSF038D12- CTATGAAAGATGTACAAGATTAAAGACAATATCCAACTCACGCTCGGCTACCATGATGCA
                      ____________________________________________________________
consensus CTATGAAAGATGTACAAGATTAAAGACAATATCCAACTCACGCTCGGCTACCATGATGCA
 
. : . : . : . : . : . :
JMFN030K01+ AGAATCGGCTTCCAAGTCTCTGGGAGAATTCAGGGCCTCAACTGTGCACTGAACATCAGG
rJMSF050D02- AGAATCGGCTTCCAAGTCTCTGGGAGAATTCAGGGCCTCAACTGTGCACTGAACATCAGG
rJMSF038D12- AGAATCGGCTTCCAAGTCTCTGGGAGAATTCAGGGCCTCAACTGTGCACTGAACATCAGG
                      ____________________________________________________________
consensus AGAATCGGCTTCCAAGTCTCTGGGAGAATTCAGGGCCTCAACTGTGCACTGAACATCAGG
 
. : . : . : . : . : . :
JMFN030K01+ TGTGATGCCCACCTGATCAATGTCATGAAGTGCAGGTGACAGATACTTCGCCACCGTCAC
rJMSF050D02- TGTGATGCCCACCTGATCAATGTCATGAAGTGCAGGTGACAGATACTTCGCCACCGTCAC
rJMSF038D12- TGTGATGCCCACCTGATCAATGTCATGAAGTGCAGGTGACAGATACTTCGCCACCGTCAC
                      ____________________________________________________________
consensus TGTGATGCCCACCTGATCAATGTCATGAAGTGCAGGTGACAGATACTTCGCCACCGTCAC
 
. : . : . : . : . : . :
JMFN030K01+ GAACAGAGCCGAACCGTCATGCAGTTGTGTAACACTCTGTATTTTCCCTTTCCCAAAAGT
rJMSF050D02- GAACAGAGCCGAACCGTCATGCAGTTGTGTAACACTCTGTATTTTCCCTTTCCCAAAAGT
rJMSF038D12- GAACAGAGCCGAACCGTCATGCAGTTGTGTAACACTCTGTATTTTCCCTTTCCCAAAAGT
                      ____________________________________________________________
consensus GAACAGAGCCGAACCGTCATGCAGTTGTGTAACACTCTGTATTTTCCCTTTCCCAAAAGT
 
. : . : . : . : . : . :
JMFN030K01+ TTTATGCCCAACGAGAACTGCTCTACCATTGTCATGGAGGGCCCCTGCCAAAATCTCGCT
rJMSF050D02- TTTATGCCCAACGAGAACTGCTCTACCATTGTCATGGAGGGCCCCTGCCAAAATCTCGCT
rJMSF038D12- TTTATGCCCAACGAGAACTGCTCTACCATTGTCATGGAGGGCCCCTGCCAAAATCTCGCT
                      ____________________________________________________________
consensus TTTATGCCCAACGAGAACTGCTCTACCATTGTCATGGAGGGCCCCTGCCAAAATCTCGCT
 
. : . : . : . : . : . :
JMFN030K01+ AGCACTTGCACTTCCCTCATTCACAAGAACAACAAGAGGATCATGTGTTACAGCATGACC
rJMSF050D02- AGCACTTGCACTTCCCTCATTCACAAGAACAACAAGAGGATCATGTGTTACAGCATGACC
rJMSF038D12- AGCACTTGCACTTCCCTCATTCACAAGAACAACAAGAGGATCATGTGTTACAGCATGACC
                      ____________________________________________________________
consensus AGCACTTGCACTTCCCTCATTCACAAGAACAACAAGAGGATCATGTGTTACAGCATGACC
 
. : . : . : . : . : . :
JMFN030K01+ ATCCACCATGCTGATGGGTTGCATGTTACCATCTCGATCAATAGTATTCACAAGAGTCTC
rJMSF050D02- ATCCACCATGCTGATGGGTTGCATGTTACCATCTCGATCAATAGTATTCACAAGAGTCTC
rJMSF038D12- ATCCACCATGCTGATGGGTTGCATGTTACCATCTCGATCAATAGTATTCACAAGAGTCTC
                      ____________________________________________________________
consensus ATCCACCATGCTGATGGGTTGCATGTTACCATCTCGATCAATAGTATTCACAAGAGTCTC
 
. : . : . : . : . : . :
JMFN030K01+ ATCGCCATCGAGCCATAATTGGGCAATGTCAAGTCCCGCTTTGACTAGACCCCCC
rJMSF050D02- ATCGCCATCGAGCCATAATTGGGCAATGTCAAGTCCCGCTTTGACTAGACCCCCC
rJMSF038D12- ATCGCCATCGAGCCATAATTGGGCAATGTCAAGTCCCGCTTTGACTAGACCCCCCGGGTT
                      ____________________________________________________________
consensus ATCGCCATCGAGCCATAATTGGGCAATGTCAAGTCCCGCTTTGACTAGACCCCCCGGGTT
 
. : . : . : . : . : . :
rJMSF038D12- ATTCCGCAAATCTAGTATGTATGACTGTACACCCTGATTTTCCATTTCCTGAACTGTGTT
                      ____________________________________________________________
consensus ATTCCGCAAATCTAGTATGTATGACTGTACACCCTGATTTTCCATTTCCTGAACTGTGTT
 
. : . : . : . : . : . :
rJMSF038D12- CTCCATCTCCACTGCAGCAGTCTGGGAGAAAGTCGATAACTTTACATATCCGGTTTTTGA
                      ____________________________________________________________
consensus CTCCATCTCCACTGCAGCAGTCTGGGAGAAAGTCGATAACTTTACATATCCGGTTTTTGA
 
. : . : . : . : . : . :
rJMSF038D12- CAAACGACCATCAGACATCCTATGAGTGATGATGGCACTGGATATAGGCGAAAGTTTTAT
                      ____________________________________________________________
consensus CAAACGACCATCAGACATCCTATGAGTGATGATGGCACTGGATATAGGCGAAAGTTTTAT
 
. : . : . : . : . : . :
rJMSF038D12- TACTTCACGAGGTAGTTTAACCTCTCTGAGGTCATTTCTTCCTGAGACATTACCACTATG
                      ____________________________________________________________
consensus TACTTCACGAGGTAGTTTAACCTCTCTGAGGTCATTTCTTCCTGAGACATTACCACTATG
 
. : . : . : . : . : . :
rJMSF038D12- GACTTTTACTGTGACAGTTGTACCGGGCACGTCCCCTCAATTTCTGTGCTGCTGCTTCAC
                      ____________________________________________________________
consensus GACTTTTACTGTGACAGTTGTACCGGGCACGTCCCCTCAATTTCTGTGCTGCTGCTTCAC