Previous Contig 013142:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF024H05Sequence648006219 (2)766013142 (4)gb:AY150441_15850061e-67Arabidopsis thaliana unknown protein (At1g17690) mRNA, complete cds.
JMSF025H05Sequence618013142 (4)gb:AY150441_15850065e-50Arabidopsis thaliana unknown protein (At1g17690) mRNA, complete cds.
JMSF038C19Sequence670006219 (2)890013142 (4)gb:AY150441_15850063e-77Arabidopsis thaliana unknown protein (At1g17690) mRNA, complete cds.
JMSF047K05Sequence702020391692013142 (4)gb:AY150441_15850067e-58Arabidopsis thaliana unknown protein (At1g17690) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038C19+ TACAGACAAACAATGATTTTTAGTTCCACATGTAAACCCAGATATCAATG
                      ____________________________________________________________
consensus TACAGACAAACAATGATTTTTAGTTCCACATGTAAACCCAGATATCAATG
 
. : . : . : . : . : . :
rJMSF024H05+ AGTGGTATGTGACAATA
rJMSF038C19+ CTTTATTCAACCACCATTGCCTCAACTATGAGGGAAAGGTTAAAGTGGTATGTGACAATA
                      ____________________________________________________________
consensus CTTTATTCAACCACCATTGCCTCAACTATGAGGGAAAGGTTAAAGTGGTATGTGACAATA
 
. : . : . : . : . : . :
rJMSF024H05+ AAGGTGTTCTACCAAAAGTAGTGCTTCAAATACGCCAGGTTTATGAACGTTTCGATACTA
rJMSF038C19+ AAGGTGTTCTACCAAAAGTAGTGCTTCAAATACGCCAGGTTTATGAACGTTTCGATACTA
                      ____________________________________________________________
consensus AAGGTGTTCTACCAAAAGTAGTGCTTCAAATACGCCAGGTTTATGAACGTTTCGATACTA
 
. : . : . : . : . : . :
rJMSF025H05+ TATTTTACTNAACAGGTGNNTCCTA
rJMSF024H05+ AGACAATAGAAGATGCAGATGAATCTCGTTTTGAATATTTTACTAAACAGGTGTATCCTA
rJMSF047K05+ ATAGANGATGCAGATGAATCTCGTTTTGAATATTTTACTAAACAGGTGTATCCTA
rJMSF038C19+ AGACAATAGAAGATGCAGATGAATCTCGTTTTGAATATTTTACTAAACAGGTGTATCCTA
                      ____________________________________________________________
consensus AGACAATAGAAGATGCAGATGAATCTCGTTTTGAATATTTTACTAAACAGGTGTATCCTA
 
. : . : . : . : . : . :
rJMSF025H05+ AGATAAAAGATTCAATACAGGGTGGCACCATGATATTCATTAGTTCTTACTTNGATNTTG
rJMSF024H05+ AGATAAAAGATTCAATACAGGGTGGCACCATGATATTCATTAGTTCTTACTTTGATTTTG
rJMSF047K05+ AGATAAAAGATTCAATACAGGGTGGCACCATGATATTCATTAGTTCTTACTTTGATTTTG
rJMSF038C19+ AGATAAAAGATTCAATACAGGGTGGCACCATGATATTCATTAGTTCTTACTTTGATTTTG
                      ____________________________________________________________
consensus AGATAAAAGATTCAATACAGGGTGGCACCATGATATTCATTAGTTCTTACTTTGATTTTG
 
. : . : . : . : . : . :
rJMSF025H05+ TCCGGTTAAGAAATTTCCNGAAGTCACAGGAGGCGTCGTTTTGTATGCTGGGAGAGTACA
rJMSF024H05+ TCCGGTTAAGAAATTTCCTGAAGTCACAGGAGGCGTCGTTTTGTATGCTGGGAGAGTACA
rJMSF047K05+ TCCGGTTAAGAAATTTCCTGAAGTCACAGGAGGCGTCGTTTTGTATGCTGGGAGAGTACA
rJMSF038C19+ TCCGGTTAAGAAATTTCCTGAAGTCACAGGAGGCGTCGTTTTGTATGCTGGGAGAGTACA
                      ____________________________________________________________
consensus TCCGGTTAAGAAATTTCCTGAAGTCACAGGAGGCGTCGTTTTGTATGCTGGGAGAGTACA
 
. : . : . : . : . : . :
rJMSF025H05+ CAAAACAAAGTGATATCTCTCGCGCAAGAGTTTGGTTCTTTAATGGAAATNGGAAAATCA
rJMSF024H05+ CAAAACAAAGTGATATCTCTCGCGCAAGAGTTTGGTTCTTTAATGGAAATCGGAAAATCA
rJMSF047K05+ CAAAACAAAGTGATATCTCTCGCGCAAGAGTTTGGTTCTTTAATGGAAATCGGAAAATCA
rJMSF038C19+ CAAAACAAAGTGATATCTCTCGCGCAAGAGTTTGGTTCTTTAATGGAAATCGGAAAATCA
                      ____________________________________________________________
consensus CAAAACAAAGTGATATCTCTCGCGCAAGAGTTTGGTTCTTTAATGGAAATCGGAAAATCA
 
. : . : . : . : . : . :
rJMSF025H05+ TGCTCTACACTGAGAGAGCTCACTTCTATCACAGATACAAGATTNGTGGCATTCAAAACC
rJMSF024H05+ TGCTCTACACTGAGAGAGCTCACTTCTATCACAGATACAAGATTCGTGGCATTCAAAACC
rJMSF047K05+ TGCTCTACACTGAGAGAGCTCACTTCTATCACAGATACAAGATTCGTGGCATTCAAAACC
rJMSF038C19+ TGCTCTACACTGAGAGAGCTCACTTCTATCACAGATACAAGATTCGTGGCATTCAAAACC
                      ____________________________________________________________
consensus TGCTCTACACTGAGAGAGCTCACTTCTATCACAGATACAAGATTCGTGGCATTCAAAACC
 
. : . : . : . : . : . :
rJMSF025H05+ TGATCATCTATTCGCTGCCAGAGAGGAAAGAAATTTACCCTGAGATTGCTAATATGCTAC
rJMSF024H05+ TGATCATCTATTCGCTGCCAGAGAGGAAAGAAATTTACCCTGAGATTGCTAATATGCTAC
rJMSF047K05+ TGATCATCTATTCGCTGCCAGAGAGGAAAGAAATTTACCCTGAGATTGCTAATATGCTAC
rJMSF038C19+ TGATCATCTATTCGCTGCCAGAGAGGAAAGAAATTTACCCTGAGATTGCTAATATGCTAC
                      ____________________________________________________________
consensus TGATCATCTATTCGCTGCCAGAGAGGAAAGAAATTTACCCTGAGATTGCTAATATGCTAC
 
. : . : . : . : . : . :
rJMSF025H05+ AAGGCACGACTTGCACAGTTTTGTTTTCTCGCTTTGACCTCCTCCGGCTTGAAAGAATCG
rJMSF024H05+ AAGGCACGACTTGCACAGTTTTGTTTTCTCGCTTTGACCTCCTCCGGCTTGAAAGAATCG
rJMSF047K05+ AAGGCACGACTTGCACAGTTTTGTTTTCTCGCTTTGACCTCCTCCGGCTTGAAAGAATCG
rJMSF038C19+ AAGGCACGACTTGCACAGTTTTGTTTTCTCGCTTTGACCTCCTCCGGCTTGAAAGAATCG
                      ____________________________________________________________
consensus AAGGCACGACTTGCACAGTTTTGTTTTCTCGCTTTGACCTCCTCCGGCTTGAAAGAATCG
 
. : . : . : . : . : . :
rJMSF025H05+ TCGGTTCTGCTGCTGCAAAACGGATGGTATCCTCAGACCAAGGCATGTTCATCTTNGCTT
rJMSF024H05+ TCGGTTCTGCTGCTGCAAAACGGATGGTATCCTCAGACCAAGGCATGTTCATCTTTGCTT
rJMSF047K05+ TCGGTTCTGCTGCTGCAAAACGGATGGTATCCTCAGACCAAGGCATGTTCATCTTTGCTT
rJMSF038C19+ TCGGTTCTGCTGCTGCAAAACGGATGGTATCCTCAGACCAAGGCATGTTCATCTTTGCTT
                      ____________________________________________________________
consensus TCGGTTCTGCTGCTGCAAAACGGATGGTATCCTCAGACCAAGGCATGTTCATCTTTGCTT
 
. : . : . : . : . : . :
rJMSF025H05+ AAAATTAGATCAACAGTTGATGCATGGATCCCAGGAAGCTTGAGAGCAGTAGTTGCATGA
rJMSF024H05+ AAAATTAGATCAACAGTTGATGCATGGATCCCAGGAAGCTTGAGAGCAGTAGTTGCATGA
rJMSF047K05+ AAAATTAGATCAACAGTTGATGCATGGATCCCAGGAAGCTTGAGAGCAGTAGTTGCATGA
rJMSF038C19+ AAAATTAGATCAACAGTTGATGCATGGATCCCAGGAAGCTTGAGAGCAGTAGTTGCATGA
                      ____________________________________________________________
consensus AAAATTAGATCAACAGTTGATGCATGGATCCCAGGAAGCTTGAGAGCAGTAGTTGCATGA
 
. : . : . : . : . : . :
rJMSF025H05+ ATTCCTTGCTCCAAAATTNTGTACCTCACAAGNCTTTCTTTCANAATTTTTGGGAAAGAC
rJMSF024H05+ ATTCCTTGCTCCAAAATTTTGTACCTCACAAGTTTTTCTTTCAAAATTTTTGGGAAAGAC
rJMSF047K05+ ATTCCTTGCTCCAAAATTTTGTACCTCACAAGTTTTTCTTTCAAAATTTTTGGGAAAGAC
rJMSF038C19+ ATTCCTTGCTCCAAAATTTTGTACCTCACAAGTTTTTCTTTCAAAATTTTTGGGAAAGAC
                      ____________________________________________________________
consensus ATTCCTTGCTCCAAAATTTTGTACCTCACAAGTTTTTCTTTCAAAATTTTTGGGAAAGAC
 
. : . : . : . : . : . :
rJMSF025H05+ TTCCCTGAATCNATCCAANNGTCATTTATTTTGCTNTCTAGTCATAGATAGGA
rJMSF024H05+ TTCACTGAATCAATCCAATTGTCATTTATTTTGCTTTCTAGTCATAGATAGGAACAACTT
rJMSF047K05+ TTCACTGAATCAATCCAATTGTCATTTATTTTGCTTTCTAGTCATAGATAGGAACAACTT
rJMSF038C19+ TTCACTGAATCAATCCAATTGTCATTTATTTTGCTTTCTAGTCATAGATAGGAACAACTT
                      ____________________________________________________________
consensus TTCACTGAATCAATCCAATTGTCATTTATTTTGCTTTCTAGTCATAGATAGGAACAACTT
 
. : . : . : . : . : . :
rJMSF024H05+ GTGTACCCAATGTATTCAATCTT
rJMSF047K05+ GTGTACCCAATGTATTCAATCTTTAGATTGTTGTGTT
rJMSF038C19+ GTGTACCCAATGTATTCAATCTTTAGATTGTTGTGTTTATTATAAACAATAATTAAAATT
                      ____________________________________________________________
consensus GTGTACCCAATGTATTCAATCTTTAGATTGTTGTGTTTATTATAAACAATAATTAAAATT