Previous Contig 013131:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF037O21Sequence678013131 (4)gb:AY084395_15694852e-15Arabidopsis thaliana clone 106836 mRNA, complete sequence.614013131 (4)gb:AK118112_18161070.003Arabidopsis thaliana At3g49290 mRNA for unknown protein, complete cds, clone: RA
JMSF038O21Sequence290013131 (4)501013131 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037O21- GGCCCCTATAACTT
                      ____________________________________________________________
consensus GGCCCCTATAACTT
 
. : . : . : . : . : . :
JMSF037O21- TAAACCCCAAATCACGTGATTCTCTCAGACCAAAAACTTTGGCTTCAATATGGGAAGTGA
                      ____________________________________________________________
consensus TAAACCCCAAATCACGTGATTCTCTCAGACCAAAAACTTTGGCTTCAATATGGGAAGTGA
 
. : . : . : . : . : . :
JMSF037O21- ATCTCCTTCCTCTTTTCCATTAAATGCTCCTACACAAACTTCCAACTCTGATGAAATCTT
                      ____________________________________________________________
consensus ATCTCCTTCCTCTTTTCCATTAAATGCTCCTACACAAACTTCCAACTCTGATGAAATCTT
 
. : . : . : . : . : . :
JMSF037O21- TATGCACCACAGCTTACACTTCACTCAAAGTCTGAAGGAATTGAAGAGTTTAAGGAAACA
                      ____________________________________________________________
consensus TATGCACCACAGCTTACACTTCACTCAAAGTCTGAAGGAATTGAAGAGTTTAAGGAAACA
 
. : . : . : . : . : . :
JMSF037O21- GTTGTACTCAGCAGCAGAGTATTTTGAGGTGTCATATGGGAAAGATGATCAGAAGCAGCT
                      ____________________________________________________________
consensus GTTGTACTCAGCAGCAGAGTATTTTGAGGTGTCATATGGGAAAGATGATCAGAAGCAGCT
 
. : . : . : . : . : . :
JMSF038O21- TTGTTTATGATTACNCCAAAGTATCGGAAACGCTATGTCAA
JMSF037O21- CGGCCTTATGCAACAATCGTTGTTTATGATTACACCAAAGTATCGGAAACGCTATGTCAA
                      ____________________________________________________________
consensus CGGCCTTATGCAACAATCGTTGTTTATGATTACACCAAAGTATCGGAAACGCTATGTCAA
 
. : . : . : . : . : . :
JMSF038O21- TCCNTCTAGGGATACAATGGGTGCCTTACGCAAGTCAGATGAGAACATTACTTTTGANAA
JMSF037O21- TCCATCTAGGGATACAATGGGTGCCTTACGCAAGTCAGATGAGAACATTACTTTTGAAAA
                      ____________________________________________________________
consensus TCCATCTAGGGATACAATGGGTGCCTTACGCAAGTCAGATGAGAACATTACTTTTGAAAA
 
. : . : . : . : . : . :
JMSF038O21- AGCCTCNATCTATTTTCAAGATGACATACACCAGAGTCAGCACAAGCAAGGTCACTGTTT
JMSF037O21- AGCCTCAATCTATTTTCAAGATGACATACACCAGAGTCAGCACAAGCAAGGTCACTGTTT
                      ____________________________________________________________
consensus AGCCTCAATCTATTTTCAAGATGACATACACCAGAGTCAGCACAAGCAAGGTCACTGTTT
 
. : . : . : . : . : . :
JMSF038O21- GACATCAGCTTTTCTAGGAGCAACAACNAAGGCCCTACCTCCCTTGCCTAGGAAAAGGCA
JMSF037O21- GACATCAGCTTTTCTAGGAGCAACAACAAAGGCCCTACCTCCCTTGCCTAGGAAAAGGCA
                      ____________________________________________________________
consensus GACATCAGCTTTTCTAGGAGCAACAACAAAGGCCCTACCTCCCTTGCCTAGGAAAAGGCA
 
. : . : . : . : . : . :
JMSF038O21- ATCAAAGNCATCATCAANAGAAACTTTTCCAAATTCTCTTGCCTTTTCNTTCACNAGAGC
JMSF037O21- ATCAAAGCCATCATCAATAGAAACTTTTCCAAATTCTCTTGCCTTTTCATTCACAAGAGC
rJMSF037O21+ TCATTCACAAGAGC
                      ____________________________________________________________
consensus ATCAAAGCCATCATCAATAGAAACTTTTCCAAATTCTCTTGCCTTTTCATTCACAAGAGC
 
. : . : . : . : . : . :
JMSF038O21- TGCATCCAA
JMSF037O21- TGCATCCAACAAAGAAGTGGGGAAACGACCACATTCTCCACTTCGCTTTACACTCAAGCG
rJMSF037O21+ TGCATCCAACAAAGAAGTGGGGAAACGACCACATTCTCCACTTCGCTTTACACTCAAGCG
                      ____________________________________________________________
consensus TGCATCCAACAAAGAAGTGGGGAAACGACCACATTCTCCACTTCGCTTTACACTCAAGCG
 
. : . : . : . : . : . :
JMSF037O21- TTCTGGATCATATGCTAATAGATCAACTTCTCCCACTGCTTGCAATAAACAACGGTGTCC
rJMSF038O21+ CTTGCAATAANCANCGGTGTCC
rJMSF037O21+ TTCTGGATCATATGCTAATAGATCAACTTCTCCCACTGCTTGCAATAAACAACGGTGTCC
                      ____________________________________________________________
consensus TTCTGGATCATATGCTAATAGATCAACTTCTCCCACTGCTTGCAATAAACAACGGTGTCC
 
. : . : . : . : . : . :
JMSF037O21- ATCA
rJMSF038O21+ ATCAGAGCCGAGGAGAACAGTTCACACATNTATAAATCCAGCAAAAANCACTACNCAAGA
rJMSF037O21+ ATCAGAGCCGAGGAGAACAGTTCACACATCTATAAATCCAGCAAAAAACACTACACAAGA
                      ____________________________________________________________
consensus ATCAGAGCCGAGGAGAACAGTTCACACATCTATAAATCCAGCAAAAAACACTACACAAGA
 
. : . : . : . : . : . :
rJMSF038O21+ TATGGANCTCCTNTCCAAAAAGAGTNAACATCTNCTCAAAGCNTTGTTTNGCATCACCAG
rJMSF037O21+ TATGGAACTCCTATCCAAAAAGAGTAAACATCTACTCAAAGCATTGCTTAGCATCAACAG
                      ____________________________________________________________
consensus TATGGAACTCCTATCCAAAAAGAGTAAACATCTACTCAAAGCATTGTTTAGCATCACCAG
 
. : . : . : . : . : . :
rJMSF038O21+ ATCACAAAAAGGAGTACCATCCAGATACCAGGATGACAGGTGAAAGAGCAAAGGAATCAA
rJMSF037O21+ ATCACAAAAAGGAGTACCATCCAGATACCAGGATGACAGGTGAAAGAGCAAAGGAATCAA
                      ____________________________________________________________
consensus ATCACAAAAAGGAGTACCATCCAGATACCAGGATGACAGGTGAAAGAGCAAAGGAATCAA
 
. : . : . : . : . : . :
rJMSF038O21+ ACCATNTTCTTGATAAGGAATATGGACTGTATTGTATCTTGTAAATACCTGTGTTTTGTT
rJMSF037O21+ ACAATCTACTTGATAAGGAATATGGACTGTATTGTATCTTGTAAATAACTGTGTTTTGTT
                      ____________________________________________________________
consensus ACCATCTTCTTGATAAGGAATATGGACTGTATTGTATCTTGTAAATACCTGTGTTTTGTT
 
. : . : . : . : . : . :
rJMSF038O21+ CTTGATCAAGTCAAAGAAGAGCCTTTTCATCTGGGATGAAATTGTAACATTTTGGTTTAG
rJMSF037O21+ CTTGATCAAGTCAAAGAAGAGCCTTTTCATCTGGGATGAAATTGTAACATTTTGGTTTAG
                      ____________________________________________________________
consensus CTTGATCAAGTCAAAGAAGAGCCTTTTCATCTGGGATGAAATTGTAACATTTTGGTTTAG
 
. : . : . : . : . : . :
rJMSF038O21+ TNCCAAAAGATNCAGTAAAGTACTCGTAAATAGGGAGTACTACATTTGGGACATTGTNAG
rJMSF037O21+ TGCCAAAAGATGCAGTAAAGTACTCGTAAATAGGGAGTACTACATTTGGGACATTGTAAG
                      ____________________________________________________________
consensus TGCCAAAAGATGCAGTAAAGTACTCGTAAATAGGGAGTACTACATTTGGGACATTGTAAG
 
. : . : . : . : . : . :
rJMSF038O21+ AATATNNAATGTTTCTCCNTGCCAGAAACAATCGAATTATGCNCTGTAAAGNTTNAGAAA
rJMSF037O21+ AATATAGAATGTTTCTCCTTGCCAGAAACAATTGAATTATGCACTGTAAAGGTTAAGAAA
                      ____________________________________________________________
consensus AATATAGAATGTTTCTCCTTGCCAGAAACAATTGAATTATGCACTGTAAAGGTTAAGAAA
 
. : . : . : . : . : . :
rJMSF038O21+ GTGAAGGTCGAACAAAGCCAAAACTGATGCAGGCTAATTTGTAAAAAGTCATGCNGGCT
rJMSF037O21+ GTGAAGGTCGAACAAAGCCAAAACTGATGCAGGCTAATTTGTAAAAAGTCATGCAGGCTT
                      ____________________________________________________________
consensus GTGAAGGTCGAACAAAGCCAAAACTGATGCAGGCTAATTTGTAAAAAGTCATGCAGGCTT