Previous Contig 013126:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF037N23Sequence663013126 (2)pir|A96712|A967126e-26probable transcription factor F14K14.16 [imported] - Arabidopsis thaliana>gb:AE0582013126 (2)pir|A96712|A967126e-24probable transcription factor F14K14.16 [imported] - Arabidopsis thaliana>gb:AE0

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF037N23- GGCCATGGCTGCAAGCGTTTGGG
                      ____________________________________________________________
consensus GGCCATGGCTGCAAGCGTTTGGG
 
. : . : . : . : . : . :
JMSF037N23- GAAGCAGAATCAGCTCCTTTCATAATCCCAAGCCTCTCAATTCCTCCTCCGCATCAACCA
                      ____________________________________________________________
consensus GAAGCAGAATCAGCTCCTTTCATAATCCCAAGCCTCTCAATTCCTCCTCCGCATCAACCA
 
. : . : . : . : . : . :
JMSF037N23- ATTTCAAAACCCATTTAACCATTTCCTCCCTTCCATGCCATCACTTCTTCAGACCCAATA
                      ____________________________________________________________
consensus ATTTCAAAACCCATTTAACCATTTCCTCCCTTCCATGCCATCACTTCTTCAGACCCAATA
 
. : . : . : . : . : . :
JMSF037N23- ACAATTCTAAACCCCTCAAATCCACAAGGATGGGGATTTCTTACCAAAAATGGGAGCCAA
rJMSF037N23+ AATCCACAAGGATGGGGATTTCTTACCAAAAATGGGAGCCAA
                      ____________________________________________________________
consensus ACAATTCTAAACCCCTCAAATCCACAAGGATGGGGATTTCTTACCAAAAATGGGAGCCAA
 
. : . : . : . : . : . :
JMSF037N23- AAAAGAAGCCGTTTCGGATGCCAATAGTGTCTTGTTTAGTAGAAGATACTCCTGAAAATT
rJMSF037N23+ AAAAGAAGCCGTTTCGGATGCCAATAGTGTCTTGTTTAGTAGAAGATACTCCTGAAAATT
                      ____________________________________________________________
consensus AAAAGAAGCCGTTTCGGATGCCAATAGTGTCTTGTTTAGTAGAAGATACTCCTGAAAATT
 
. : . : . : . : . : . :
JMSF037N23- TCCCGGAATCAGGCTCAAATGATTCTTCCGCGGAAGTGGTTTTTGACTTGAAGCTCCCGA
rJMSF037N23+ TCCCGGAATCAGGCTCAAATGATTCTTCCGCGGAAGTGGTTTTTGACTTGAAGCTCCCGA
                      ____________________________________________________________
consensus TCCCGGAATCAGGCTCAAATGATTCTTCCGCGGAAGTGGTTTTTGACTTGAAGCTCCCGA
 
. : . : . : . : . : . :
JMSF037N23- GGAGAAGTTTGTTAGCAACTTTCACATGCAATGCATGTGGTGTGCGATCTCAAAGGTTCA
rJMSF037N23+ GGAGAAGTTTGTTAGCAACTTTCACATGCAATGCATGTGGTGTGCGATCTCAAAGGTTCA
                      ____________________________________________________________
consensus GGAGAAGTTTGTTAGCAACTTTCACATGCAATGCATGTGGTGTGCGATCTCAAAGGTTCA
 
. : . : . : . : . : . :
JMSF037N23- TAAACAGATTAGCTTATGAAAGAGGACTTGTCTATGTGCAGTGTTCAGGGTGCTCTAAGT
rJMSF037N23+ TAAACAGATTAGCTTATGAAAGAGGACTTGTCTATGTGCAGTGTTCAGGGTGCTCTAAGT
                      ____________________________________________________________
consensus TAAACAGATTAGCTTATGAAAGAGGACTTGTCTATGTGCAGTGTTCAGGGTGCTCTAAGT
 
. : . : . : . : . : . :
JMSF037N23- ATCACAAATTGGTAGACAATCTTGGACTTGTAGTTGAGTACAACTTGGGAGATGAATATG
rJMSF037N23+ ATCACAAATTGGTAGACAATCTTGGACTTGTAGTTGAGTACAACTTGGGAGATGAATATG
                      ____________________________________________________________
consensus ATCACAAATTGGTAGACAATCTTGGACTTGTAGTTGAGTACAACTTGGGAGATGAATATG
 
. : . : . : . : . : . :
JMSF037N23- GTGAGGATTCATAGGCAAATCAAGCTTGAAGGGATTTACTGAATTGATTACAGATCAAAA
rJMSF037N23+ GTGAGGATTCATAGGCAAATCAAGCTTGAAGGGATTTACTGAATTGATTACAGATCAAAA
                      ____________________________________________________________
consensus GTGAGGATTCATAGGCAAATCAAGCTTGAAGGGATTTACTGAATTGATTACAGATCAAAA
 
. : . : . : . : . : . :
JMSF037N23- GCCATTGTATGTACAGATCAAATATATCTACAAGGAGTTTGTTTATTATATCTATCTGTT
rJMSF037N23+ GCCATTGTATGTACAGATCAAATATATCTACAAGGAGTTTGTTTATTATATCTATCTGTT
                      ____________________________________________________________
consensus GCCATTGTATGTACAGATCAAATATATCTACAAGGAGTTTGTTTATTATATCTATCTGTT
 
. : . : . : . : . : . :
JMSF037N23- GTGATAAAAATCTTCCACTTAAGAAACAATGATTTATCCC
rJMSF037N23+ GTGATAAAAATCTTCCACTTAAGAAACAATGATTTATCCCCTTATTATTGTTTTGTTTAA
                      ____________________________________________________________
consensus GTGATAAAAATCTTCCACTTAAGAAACAATGATTTATCCCCTTATTATTGTTTTGTTTAA
 
. : . : . : . : . : . :
rJMSF037N23+ GCATGCATGTAAATGTCCAACCTTATCAAAAATTTTGTATTGATAAGGCTAGATATAGCC
                      ____________________________________________________________
consensus GCATGCATGTAAATGTCCAACCTTATCAAAAATTTTGTATTGATAAGGCTAGATATAGCC